Skip to Content
Merck
CN

EHU092531

MISSION® esiRNA

targeting human STT3A

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human STT3A

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCTGATGCCCGGATTTTTATCATCATGTATGGTGTGACCAGCATGTACTTTTCAGCTGTAATGGTGCGTCTAATGCTAGTGTTGGCACCTGTTATGTGCATTCTCTCTGGCATTGGAGTCTCCCAGGTGCTGTCCACATACATGAAGAATCTGGACATAAGTCGTCCAGACAAGAAGAGCAAGAAGCAACAGGATTCCACCTACCCTATTAAGAATGAAGTGGCAAGTGGGATGATACTGGTCATGGCTTTCTTTCTCATCACCTACACCTTTCATTCAACCTGGGTGACCAGTGAGGCCTACTCTTCTCCGTCCATTGTACTATCTGCCCGTGGTGGGGATGGCAGTAGGATCATATTTGATGACTTCCGAGAAGCATATTATTGGCTTCGTCATAATACTCCAGAGGATGCGAAGGTCATGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Peyman Eivazy et al.
Artificial cells, nanomedicine, and biotechnology, 45(5), 889-896 (2016-05-18)
High-mobility group protein two (HMGA2), a nonhistone nuclear-binding protein and its downregulators; vimentin, matrix metallopeptidase-9 (MMP-9), and E-cadherin are shown to contribute to tumor progression and metastasis. Thus, in this study, we checked simultaneous delivery of HMGA-2 siRNA and the
Shiteshu Shrimal et al.
The Journal of cell biology, 216(11), 3625-3638 (2017-09-02)
In metazoan organisms, the STT3A isoform of the oligosaccharyltransferase is localized adjacent to the protein translocation channel to catalyze co-translational N-linked glycosylation of proteins in the endoplasmic reticulum. The mechanism responsible for the interaction between the STT3A complex and the
Li-Chuan Chan et al.
The Journal of clinical investigation, 129(8), 3324-3338 (2019-07-16)
Glycosylation of immune receptors and ligands, such as T cell receptor and coinhibitory molecules, regulates immune signaling activation and immune surveillance. However, how oncogenic signaling initiates glycosylation of coinhibitory molecules to induce immunosuppression remains unclear. Here we show that IL-6-activated

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service