Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTCTGATGCCCGGATTTTTATCATCATGTATGGTGTGACCAGCATGTACTTTTCAGCTGTAATGGTGCGTCTAATGCTAGTGTTGGCACCTGTTATGTGCATTCTCTCTGGCATTGGAGTCTCCCAGGTGCTGTCCACATACATGAAGAATCTGGACATAAGTCGTCCAGACAAGAAGAGCAAGAAGCAACAGGATTCCACCTACCCTATTAAGAATGAAGTGGCAAGTGGGATGATACTGGTCATGGCTTTCTTTCTCATCACCTACACCTTTCATTCAACCTGGGTGACCAGTGAGGCCTACTCTTCTCCGTCCATTGTACTATCTGCCCGTGGTGGGGATGGCAGTAGGATCATATTTGATGACTTCCGAGAAGCATATTATTGGCTTCGTCATAATACTCCAGAGGATGCGAAGGTCATGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... STT3A(3703)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Peyman Eivazy et al.
Artificial cells, nanomedicine, and biotechnology, 45(5), 889-896 (2016-05-18)
High-mobility group protein two (HMGA2), a nonhistone nuclear-binding protein and its downregulators; vimentin, matrix metallopeptidase-9 (MMP-9), and E-cadherin are shown to contribute to tumor progression and metastasis. Thus, in this study, we checked simultaneous delivery of HMGA-2 siRNA and the
Li-Chuan Chan et al.
The Journal of clinical investigation, 129(8), 3324-3338 (2019-07-16)
Glycosylation of immune receptors and ligands, such as T cell receptor and coinhibitory molecules, regulates immune signaling activation and immune surveillance. However, how oncogenic signaling initiates glycosylation of coinhibitory molecules to induce immunosuppression remains unclear. Here we show that IL-6-activated
Shiteshu Shrimal et al.
The Journal of cell biology, 216(11), 3625-3638 (2017-09-02)
In metazoan organisms, the STT3A isoform of the oligosaccharyltransferase is localized adjacent to the protein translocation channel to catalyze co-translational N-linked glycosylation of proteins in the endoplasmic reticulum. The mechanism responsible for the interaction between the STT3A complex and the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU092531-50UG | 04061828362202 |
| EHU092531-20UG | 04061828597154 |