Skip to Content
Merck
CN

EHU092791

MISSION® esiRNA

targeting human AKAP12

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTCCTAGATGTAACATTCCTGATCAAGGTACAATTCTTTAAAATTCACTAATGATTGAGGTCCATATTTAGTGGTACTCTGAAATTGGTCACTTTCCTATTACACGGAGTGTGCTAAAACTAAAAAGCATTTTGAAACATACAGAATGTTCTATTGTCATTGGGAAATTTTTCTTTCTAACCCAGTGGAGGTTAGAAAGAAGTTATATTCTGGTAGCAAATTAACTTTACATCCTTTTTCCTACTTGTTATGGTTGTTTGGACCGATAAGTGTGCTTAATCCTGAGGCAAAGTAGTGAATATGTTTTATATGTTATGAAGAAAAGAATTGTTGTAAGTTTTTGATTCTACTCTTATATGCTGGACTGCATTCACACATGGCATGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Takakuni Maki et al.
Stem cells (Dayton, Ohio), 36(5), 751-760 (2018-01-10)
Oligodendrocyte precursor cells (OPCs) give rise to oligodendrocytes in cerebral white matter. However, the underlying mechanisms that regulate this process remain to be fully defined, especially in adult brains. Recently, it has been suggested that signaling via A-kinase anchor protein
Yanli Yu et al.
Neurochemical research, 45(2), 310-321 (2019-11-30)
Docosahexaenoic acid (DHA) can alleviate cerebral ischemia/reperfusion injury by reducing blood-brain barrier permeability and maintaining its integrity, accompanied by an increased Ang-1/Ang-2 ratio; however, the underlying mechanisms of these effects remain unclear. Src-suppressed C kinase substrates (SSeCKS), a substrate of
Hua Wei et al.
Neurochemical research, 44(4), 839-848 (2019-02-02)
Astrocytes migration is essential in the formation of the glial scar during the injury response process of the central nervous system (CNS) especially during inflammation. Integrin β1 is part of the extracellular matrix receptors in the CNS and it has

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service