Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTTTTGGCCAGAACTGAAGCAGATTACCTGGCTCAGTGTCACAGGGCTGCTGATGGTGGTCTTCGGAGAATGTCTGAGGAAGGCGGCCATGTTTACAGCTGGCTCCAATTTCAACCACGTGGTACAGAATGAAAAATCAGATACACATACTCTGGTGACCAGTGGAGTGTACGCTTGGTTTCGGCATCCTTCTTACGTCGGGTGGTTTTACTGGAGTATTGGAACTCAGGTGATGCTGTGTAACCCCATCTGCGGCGTCAGCTATGCCCTGACAGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ICMT(23463)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Qiong Liu et al.
Biochemical and biophysical research communications, 501(2), 556-562 (2018-05-11)
Inhibition of isoprenylcysteine carboxylmethyltransferase (Icmt), which catalyzes the final step of oncoproteins' prenylation, targets growth and survival of various cancers. In this work, we systematically studied the expression, functions and molecular signaling of Icmt in ovarian cancer. We show that
Yongbo Zhu et al.
Biochemical and biophysical research communications, 516(3), 784-789 (2019-06-30)
Development of chemo-resistance in nasopharyngeal carcinoma (NPC) poses the therapeutic challenge and its mechanisms are still poorly understood. In this work, we demonstrate that targeting isoprenylcysteine carboxylmethyltransferase (Icmt) is a therapeutic strategy to overcome NPC chemo-resistance. We found that Icmt
Woo Seok Yang et al.
Cells, 9(5) (2020-05-20)
In this study, we investigated the functional role of isoprenylcysteine carboxyl methyltransferase (ICMT) and its methylatable substrate Ras in Toll-like receptor (TLR)-activated macrophages and in mouse inflammatory disease conditions. ICMT and RAS expressions were strongly increased in macrophages under the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU097461-50UG | 04061828353989 |
| EHU097461-20UG | 04061828588442 |
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service