Sign In to View Organizational & Contract Pricing.
Select a Size
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
Product Name
MISSION® esiRNA, targeting human MUTYH
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CACAGTGTGTACCCCACAGCGCCCACTGTGCAGCCAGTGCCCTGTGGAGAGCCTGTGCCGGGCACGCCAGAGAGTGGAGCAGGAACAGCTCTTAGCCTCAGGGAGCCTGTCGGGCAGTCCTGACGTGGAGGAGTGTGCTCCCAACACTGGACAGTGCCACCTGTGCCTGCCTCCCTCGGAGCCCTGGGACCAGACCCTGGGAGTGGTCAACTTCCCCAGAAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
Gene Information
human ... MUTYH(4595), MUTYH(4595)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Qingmin Sun et al.
Oxidative medicine and cellular longevity, 2020, 4828256-4828256 (2020-11-06)
Idiopathic pulmonary fibrosis (IPF) is a progressive, irreversible lung disease of unknown etiology with limited survival. IPF incidence and prevalence increase significantly with aging, which is associated with an age-related accumulation of oxidative DNA damage. The Mutyh gene is involved
Norman Chan et al.
Molecular cancer research : MCR, 12(10), 1407-1415 (2014-07-18)
Regions of acute and chronic hypoxia exist within solid tumors and can lead to increased rates of mutagenesis and/or altered DNA damage and repair protein expression. Base excision repair (BER) is responsible for resolving small, non-helix-distorting lesions from the genome
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service