Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGGCGGATTTACGACATTACCAATGTTTTGGAAGGTATCGGGCTAATCGAGAAAAAGTCCAAGAACAGCATCCAGTGGAAGGGTGTGGGGCCTGGCTGCAATACCCGGGAGATTGCTGACAAACTGATTGAGCTCAAGGCAGAGATCGAGGAGCTGCAGCAGCGGGAGCAAGAACTAGACCAGCACAAGGTGTGGGTGCAGCAGAGCATCCGGAACGTCACAGAGGACGTGCAGAACAGCTGTTTGGCCTACGTCACTCATGAGGACATCTGCAGATGCTTTGCTGGAGATACCCTCTTGGCCATCCGGGCCCCATCAGGCACCAGCCTGGAGGTGCCCATCCCAGAGGGTCTCAATGGGCAGAAGAAGTACCAGATTCACCTGAAGAGTGTGAGTGGTCCCATTGAGGTTCTGCTGGTGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... E2F4(1874)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Manikandan Periyasamy et al.
Nucleic acids research, 45(19), 11056-11069 (2017-10-05)
Cancer genome sequencing has implicated the cytosine deaminase activity of apolipoprotein B mRNA editing enzyme catalytic polypeptide-like (APOBEC) genes as an important source of mutations in diverse cancers, with APOBEC3B (A3B) expression especially correlated with such cancer mutations. To better
Zhen Zhen et al.
Cell biology international (2019-09-03)
The transcription factor E2F4 is a key determinant of cell differentiation and cell-cycle progression, but its function and regulatory mechanism are not completely understood. Here, we report that E2F4 acts as a positive regulator of the biosynthesis of milk components
Arun Kanakkanthara et al.
Nature communications, 10(1), 4632-4632 (2019-10-13)
Reduced BRCA1 expression causes homologous recombination (HR) repair defects in high-grade serous ovarian cancers (HGSOCs). Here, we demonstrate that BRCA1 is transcriptionally activated by a previously unknown function of ZC3H18. We show that ZC3H18 is a DNA-binding protein that interacts
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU102701-20UG | 04061828613137 |
| EHU102701-50UG | 04061828374274 |