Skip to Content
Merck
CN

EHU102701

MISSION® esiRNA

targeting human E2F4

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGCGGATTTACGACATTACCAATGTTTTGGAAGGTATCGGGCTAATCGAGAAAAAGTCCAAGAACAGCATCCAGTGGAAGGGTGTGGGGCCTGGCTGCAATACCCGGGAGATTGCTGACAAACTGATTGAGCTCAAGGCAGAGATCGAGGAGCTGCAGCAGCGGGAGCAAGAACTAGACCAGCACAAGGTGTGGGTGCAGCAGAGCATCCGGAACGTCACAGAGGACGTGCAGAACAGCTGTTTGGCCTACGTCACTCATGAGGACATCTGCAGATGCTTTGCTGGAGATACCCTCTTGGCCATCCGGGCCCCATCAGGCACCAGCCTGGAGGTGCCCATCCCAGAGGGTCTCAATGGGCAGAAGAAGTACCAGATTCACCTGAAGAGTGTGAGTGGTCCCATTGAGGTTCTGCTGGTGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Manikandan Periyasamy et al.
Nucleic acids research, 45(19), 11056-11069 (2017-10-05)
Cancer genome sequencing has implicated the cytosine deaminase activity of apolipoprotein B mRNA editing enzyme catalytic polypeptide-like (APOBEC) genes as an important source of mutations in diverse cancers, with APOBEC3B (A3B) expression especially correlated with such cancer mutations. To better
Zhen Zhen et al.
Cell biology international (2019-09-03)
The transcription factor E2F4 is a key determinant of cell differentiation and cell-cycle progression, but its function and regulatory mechanism are not completely understood. Here, we report that E2F4 acts as a positive regulator of the biosynthesis of milk components
Arun Kanakkanthara et al.
Nature communications, 10(1), 4632-4632 (2019-10-13)
Reduced BRCA1 expression causes homologous recombination (HR) repair defects in high-grade serous ovarian cancers (HGSOCs). Here, we demonstrate that BRCA1 is transcriptionally activated by a previously unknown function of ZC3H18. We show that ZC3H18 is a DNA-binding protein that interacts

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service