Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGTCCTGCTGTCTCTGCTGCTGCTTCTGGGTCCTGCTGTCCCCCAGGAGAACCAAGATGGTCGTTACTCTCTGACCTATATCTACACTGGGCTGTCCAAGCATGTTGAAGACGTCCCCGCGTTTCAGGCCCTTGGCTCACTCAATGACCTCCAGTTCTTTAGATACAACAGTAAAGACAGGAAGTCTCAGCCCATGGGACTCTGGAGACAGGTGGAAGGAATGGAGGATTGGAAGCAGGACAGCCAACTTCAGAAGGCCAGGGAGGACATCTTTATGGAGACCCTGAAAGACATCGTGGAGTATTACAACGACAGTAACGGGTCTCACGTATTGCAGGGAAGGTTTGGTTGTGAGATCGAGAATAACAGAAGCAGCGGAGCATTCTGGAAATATTACTATGATGGAAAGGACTACATTGAATTCAACAAAGAAATCCCAGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... AZGP1(563)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xinhua Xiao et al.
Molecular and cellular endocrinology, 439, 155-164 (2016-06-07)
Zinc alpha2 glycoprotein (ZAG) plays an important role in stimulating fat mobilization and lipolysis in adipose tissue, but its role in hepatic lipid metabolism remains unclear. Palmitic acid (PA) was used to stimulate HepG2 cells with ZAG overexpression or ZAG
Yingming Xue et al.
International journal of molecular sciences, 16(1), 691-703 (2015-01-07)
Zinc-α-2-glycoprotein (AZGP1) is a 41-kDa secreted glycoprotein, which has been detected in several malignancies. The diagnostic value of AZGP1 in serum of prostate and breast cancer patients has been reported. Analyzing "The Cancer Genome Atlas" data, we found that in
P M Sanders et al.
British journal of cancer, 90(6), 1274-1278 (2004-03-18)
Lipid-mobilising factor (LMF) is produced by cachexia-inducing tumours and is involved in the degradation of adipose tissue, with increased oxidation of the released fatty acids through an induction of uncoupling protein (UCP) expression. Since UCP-2 is thought to be involved
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU104461-20UG | 04061828602193 |
| EHU104461-50UG | 04061828375547 |