Skip to Content
Merck
CN

EHU104601

MISSION® esiRNA

targeting human CHORDC1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCCCAGATGAACCAATGACAAATTTGGAATTAAAAATATCTGCCTCCCTAAAACAAGCACTTGATAAACTTAAACTGTCATCAGGGAATGAAGAAAATAAGAAAGAAGAAGACAATGATGAAATTAAGATTGGGACCTCATGTAAGAATGGAGGGTGTTCAAAGACATACCAGGGTCTAGAGAGTCTAGAAGAAGTCTGTGTATATCATTCTGGAGTACCTATTTTCCATGAGGGGATGAAATACTGGAGCTGTTGTAGAAGAAAAACTTCTGATTTTAATACATTCTTAGCCCAAGAGGGCTGTACAAAAGGGAAACACATGTGGACTAAAAAAGATGCTGGGAAAAAAGTTGTTCCATGTAGACATGACTGGCATCAGACTGGAGGTGAAGTTACCATTTCAGTATATGCTAAAAACTCACTTCCAGAACTTAGCCGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fumihiko Urabe et al.
Science advances, 6(18), eaay3051-eaay3051 (2020-06-05)
Extracellular vesicles (EVs) are involved in intercellular communication during cancer progression; thus, elucidating the mechanism of EV secretion in cancer cells will contribute to the development of an EV-targeted cancer treatment. However, the biogenesis of EVs in cancer cells is
Federica Fusella et al.
Nature communications, 8(1), 1636-1636 (2017-11-22)
NF-κB is a transcription factor involved in the regulation of multiple physiological and pathological cellular processes, including inflammation, cell survival, proliferation, and cancer cell metastasis. NF-κB is frequently hyperactivated in several cancers, including triple-negative breast cancer. Here we show that
Federica Fusella et al.
The Journal of pathology, 234(2), 152-163 (2014-03-13)
Morgana/CHP-1 is a ubiquitously expressed protein able to inhibit ROCK II kinase activity. We have previously demonstrated that morgana haploinsufficiency leads to multiple centrosomes, genomic instability, and higher susceptibility to tumour development. While a large fraction of human cancers has

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service