Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCCCAGATGAACCAATGACAAATTTGGAATTAAAAATATCTGCCTCCCTAAAACAAGCACTTGATAAACTTAAACTGTCATCAGGGAATGAAGAAAATAAGAAAGAAGAAGACAATGATGAAATTAAGATTGGGACCTCATGTAAGAATGGAGGGTGTTCAAAGACATACCAGGGTCTAGAGAGTCTAGAAGAAGTCTGTGTATATCATTCTGGAGTACCTATTTTCCATGAGGGGATGAAATACTGGAGCTGTTGTAGAAGAAAAACTTCTGATTTTAATACATTCTTAGCCCAAGAGGGCTGTACAAAAGGGAAACACATGTGGACTAAAAAAGATGCTGGGAAAAAAGTTGTTCCATGTAGACATGACTGGCATCAGACTGGAGGTGAAGTTACCATTTCAGTATATGCTAAAAACTCACTTCCAGAACTTAGCCGAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CHORDC1(26973)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Federica Fusella et al.
Nature communications, 8(1), 1636-1636 (2017-11-22)
NF-κB is a transcription factor involved in the regulation of multiple physiological and pathological cellular processes, including inflammation, cell survival, proliferation, and cancer cell metastasis. NF-κB is frequently hyperactivated in several cancers, including triple-negative breast cancer. Here we show that
Fumihiko Urabe et al.
Science advances, 6(18), eaay3051-eaay3051 (2020-06-05)
Extracellular vesicles (EVs) are involved in intercellular communication during cancer progression; thus, elucidating the mechanism of EV secretion in cancer cells will contribute to the development of an EV-targeted cancer treatment. However, the biogenesis of EVs in cancer cells is
Federica Fusella et al.
The Journal of pathology, 234(2), 152-163 (2014-03-13)
Morgana/CHP-1 is a ubiquitously expressed protein able to inhibit ROCK II kinase activity. We have previously demonstrated that morgana haploinsufficiency leads to multiple centrosomes, genomic instability, and higher susceptibility to tumour development. While a large fraction of human cancers has
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU104601-20UG | 04061828602315 |
| EHU104601-50UG | 04061828375684 |