Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCTATGAGAAGGTGGTGGATAGAATCCAGAGCAGTGGGAAGAATGTCACACTTCTAGTCTGTGGAAAGAAGGCCTATGATTATTTCCAAGCTAAGAAAATCCCTATTGTTTCCTCCCTGGCTGATCCACTTGACACCCCTCCAGATTCTAAAGAAGGAATAGTGGTGGAGTCAAACCATGACTCGCACATGGCAAAAGAACGGGCCCACAGTACAGCCTCACATTCTTCTTCCAATTCTGAAGATACAGAGATGTGATGAAAACAAGTAATAGCTTTGGCTGTTTATTTGATAGCTGTTTCTGGGTATTTAATAGGAATCCTTTCTCAAGGAATGAGTTGTGACCTGTTTACTGTCTCTTTAGAAGAAAAACTCCACTGGAAACCATTCACCATGTGTGATTGTCTTCTGTTATCATTTGTCTTACAGGCGGCTATTGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PDZK1(5174)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yi Shao et al.
Oncology letters, 15(5), 6655-6665 (2018-04-05)
Patients with non-small-cell lung cancer (NSCLC) with sensitive epidermal growth factor receptor (EGFR) mutations generally react well to tyrosine kinase inhibitors (TKIs). However acquired resistance eventually occurs. Several mechanisms contribute to the resistance including T790M mutation, c-Met amplification and PIK3CA
Chunjuan Zhao et al.
Cancer letters, 453, 107-121 (2019-04-02)
Phosphorylation of PTEN plays an important role in carcinogenesis and progression of gastric cancer. However, the underlying mechanism of PTEN phosphorylation regulation remains largely elusive. In the present study, PDZK1 was identified as a novel binding protein of PTEN by
Ben J Wu et al.
International journal of cardiology, 199, 204-212 (2015-07-24)
High density lipoprotein (HDL) infusions increase new blood vessel formation (angiogenesis) in rodents with ischemic injury. This study asks if increasing HDL levels by inhibiting cholesteryl ester transfer protein (CETP) activity increases angiogenesis in New Zealand White (NZW) rabbits with
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU104911-20UG | 04061828602582 |
| EHU104911-50UG | 04061828375981 |