Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCTGGGTGAAGAATGGAAGGGTTATGTGGTCCGAATCAGTGGTGGGAACGACAAACAAGGTTTCCCCATGAAGCAGGGTGTCTTGACCCATGGCCGTGTCCGCCTGCTACTGAGTAAGGGGCATTCCTGTTACAGACCAAGGAGAACTGGAGAAAGAAAGAGAAAATCAGTTCGTGGTTGCATTGTGGATGCAAATCTGAGCGTTCTCAACTTGGTTATTGTAAAAAAAGGAGAGAAGGATATTCCTGGACTGACTGATACTACAGTGCCTCGCCGCCTGGGCCCCAAAAGAGCTAGCAGAATCCGCAAACTTTTCAATCTCTCTAAAGAAGATGATGTCCGCCAGTATGTTGTAAGAAAGCCCTTAAATAAAGAAGGTAAGAAACCTAGGACCAAAGCACCCAAGATTCAGCGTCTTGTTACTCCACGTGTCCTGCAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RPS6(6194)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yun Zou et al.
Oncotarget, 8(13), 20825-20833 (2017-02-18)
Renal cell carcinoma (RCC) is a urologic malignant cancer and often diagnosed at an advanced stage, which results in high mortality. Targeted therapy may improve the quality of life and survival of patients who are not suitable for nephrectomy. Everolimus
Atsuko Tsukimoto et al.
Antiviral research, 117, 1-9 (2015-02-11)
Previous studies have demonstrated that cyclopentenone prostaglandins (cyPGs) inhibit the replication of a wide variety of DNA and RNA viruses in different mammalian cell types. We investigated a new role for prostaglandin A1 (PGA1) in the inhibition of hepatitis C
Lingqin Yuan et al.
Endocrine-related cancer, 22(4), 577-591 (2015-06-06)
Glutamine is one of the main nutrients used by tumor cells for biosynthesis. Therefore, targeted inhibition of glutamine metabolism may have anti-tumorigenic implications. In the present study, we aimed to evaluate the effects of glutamine on ovarian cancer cell growth.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU105041-20UG | 04061831357400 |
| EHU105041-50UG | 04061828376117 |