Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTCAAAGGAGGGTGATGAAAGGTGTTGATGACCTAGACTTCTTCATTGGTGATGAAGCAATAGAAAAACCTACATATGCAACAAAGTGGCCAATCCGCCATGGTATAGTTGAAGATTGGGACTTAATGGAAAGGTTTATGGAGCAAGTGATCTTTAAATATTTAAGGGCAGAACCTGAAGACCATTATTTTCTTTTGACTGAACCTCCATTGAATACTCCAGAAAACAGGGAATATACTGCTGAAATAATGTTTGAGTCCTTCAATGTTCCAGGCTTGTACATTGCTGTGCAGGCTGTTCTTGCCTTAGCTGCATCTTGGACCTCAAGACAAGTAGGAGAACGGACGTTGACCGGTACGGTAATAGACAGTGGAGATGGTGTCACTCATGTCATTCCTGTGGCTGAAGGGTATGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ACTR3(10096)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Aleksandra S Chikina et al.
Biology of the cell, 111(10), 245-261 (2019-08-14)
Metastatic disease is caused by the ability of cancer cells to reach distant organs and form secondary lesions at new locations. Dissemination of cancer cells depends on their migration plasticity - an ability to switch between motility modes driven by
Daniel L Galvan et al.
The Journal of clinical investigation, 129(7), 2807-2823 (2019-05-08)
Phosphorylation of Dynamin-related protein1 (Drp1) represents an important regulatory mechanism for mitochondrial fission. Here we established the role of Drp1 Serine 600 (S600) phosphorylation on mitochondrial fission in vivo, and assessed the functional consequences of targeted elimination of the Drp1S600
Meraj H Khan et al.
Journal of cell science, 130(18), 3094-3107 (2017-08-05)
Sharpin, a multifunctional adaptor protein, regulates several signalling pathways. For example, Sharpin enhances signal-induced NF-κB signalling as part of the linear ubiquitin assembly complex (LUBAC) and inhibits integrins, the T cell receptor, caspase 1 and PTEN. However, despite recent insights
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU108371-20UG | 04061828604487 |
| EHU108371-50UG | 04061831374575 |