Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCAAGAGGGAGATGGTGTCCCAATACTTGTACACCTCCAAGGCTGGCATGAGCCAGAAGGAGAGCTCTAAGTCTGCCATGATGTATATTCAGGAGTTGAGGTCAGGCTTGCGGGATATGCCTCTGCTCAGCTGCCTGGAGTCCCTTCGTGTGTCTCTCAACAACAACCCTGTCAGTTGGGTGCAAACATTTGGTGCTGAAGGCTTGGCCTCCTTATTGGACATTCTTAAACGACTTCATGATGAGAAAGAAGAGACTGCTGGGAGTTACGATAGCCGGAACAAGCATGAGATCATTCGCTGCTTGAAAGCTTTTATGAACAACAAGTTTGGAATCAAGACCATGTTGGAGACAGAAGAAGGAATCCTACTGCTGGTCAGAGCCATGGATCCTGCTGTTCCCAACATGATG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... DIAPH1(1729)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Salma Jalal et al.
Journal of cell science, 132(5) (2019-02-23)
Actin cytoskeleton self-organization in two cell types, fibroblasts and epitheliocytes, was studied in cells confined to isotropic adhesive islands. In fibroblasts plated onto islands of optimal size, an initially circular actin pattern evolves into a radial pattern of actin bundles
Alfonso Bolado-Carrancio et al.
eLife, 9 (2020-07-25)
Migrating cells need to coordinate distinct leading and trailing edge dynamics but the underlying mechanisms are unclear. Here, we combine experiments and mathematical modeling to elaborate the minimal autonomous biochemical machinery necessary and sufficient for this dynamic coordination and cell
Joseph Mathew Kalappurakkal et al.
Cell, 177(7), 1738-1756 (2019-05-21)
Glycosylphosphatidylinositol-anchored proteins (GPI-APs) are a major class of lipid-anchored plasma membrane proteins. GPI-APs form nanoclusters generated by cortical acto-myosin activity. While our understanding of the physical principles governing this process is emerging, the molecular machinery and functional relevance of GPI-AP
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU109471-20UG | 04061828592494 |
| EHU109471-50UG | 04061828355686 |