Skip to Content
Merck
CN

EHU109471

MISSION® esiRNA

targeting human DIAPH1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAAGAGGGAGATGGTGTCCCAATACTTGTACACCTCCAAGGCTGGCATGAGCCAGAAGGAGAGCTCTAAGTCTGCCATGATGTATATTCAGGAGTTGAGGTCAGGCTTGCGGGATATGCCTCTGCTCAGCTGCCTGGAGTCCCTTCGTGTGTCTCTCAACAACAACCCTGTCAGTTGGGTGCAAACATTTGGTGCTGAAGGCTTGGCCTCCTTATTGGACATTCTTAAACGACTTCATGATGAGAAAGAAGAGACTGCTGGGAGTTACGATAGCCGGAACAAGCATGAGATCATTCGCTGCTTGAAAGCTTTTATGAACAACAAGTTTGGAATCAAGACCATGTTGGAGACAGAAGAAGGAATCCTACTGCTGGTCAGAGCCATGGATCCTGCTGTTCCCAACATGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Alfonso Bolado-Carrancio et al.
eLife, 9 (2020-07-25)
Migrating cells need to coordinate distinct leading and trailing edge dynamics but the underlying mechanisms are unclear. Here, we combine experiments and mathematical modeling to elaborate the minimal autonomous biochemical machinery necessary and sufficient for this dynamic coordination and cell
Salma Jalal et al.
Journal of cell science, 132(5) (2019-02-23)
Actin cytoskeleton self-organization in two cell types, fibroblasts and epitheliocytes, was studied in cells confined to isotropic adhesive islands. In fibroblasts plated onto islands of optimal size, an initially circular actin pattern evolves into a radial pattern of actin bundles
Joseph Mathew Kalappurakkal et al.
Cell, 177(7), 1738-1756 (2019-05-21)
Glycosylphosphatidylinositol-anchored proteins (GPI-APs) are a major class of lipid-anchored plasma membrane proteins. GPI-APs form nanoclusters generated by cortical acto-myosin activity. While our understanding of the physical principles governing this process is emerging, the molecular machinery and functional relevance of GPI-AP

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service