Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCTCTCACGGAGGCATCTTATGTTAACCTACCTACCATTGCGCTGTGTAACACAGATTCTCCTCTGCGCTATGTGGACATTGCCATCCCATGCAACAACAAGGGAGCTCACTCAGTGGGTTTGATGTGGTGGATGCTGGCTCGGGAAGTTCTGCGCATGCGTGGCACCATTTCCCGTGAACACCCATGGGAGGTCATGCCTGATCTGTACTTCTACAGAGATCCTGAAGAGATTGAAAAAGAAGAGCAGGCTGCTGCTGAGAAGGCAGTGACCAAGGAGGAATTTCAGGGTGAATGGACTGCTCCCGCTCCTGAGTTCACTGCTACTCAGCCTGAGGTTGCAGACTGGTCTGAAGGTGTACAGGTGCCCTCTGTGCCTATTCAGCAATTCCCTACTGAAGACTGGAGCG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RPSA(3921)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Thandokuhle Khumalo et al.
PloS one, 10(10), e0139584-e0139584 (2015-10-02)
Cancer is a global burden due to high incidence and mortality rates and is ranked the second most diagnosed disease amongst non-communicable diseases in South Africa. A high expression level of the 37kDa/67kDa laminin receptor (LRP/LR) is one characteristic of
Kiashanee Moodley et al.
PloS one, 8(3), e57409-e57409 (2013-03-09)
The non-integrin laminin receptor, here designated the 37-kDa/67-kDa laminin receptor (LRP/LR), is involved in many physiologically relevant processes, as well as numerous pathological conditions. The overexpression of LRP/LR on various cancerous cell lines plays critical roles in tumour metastasis and
Guanhong Luo et al.
Oncotarget, 8(42), 71630-71641 (2017-10-27)
Cellular prion protein (PrPC), the infective agent of transmissible spongiform encephalopathies, is thought to be related to several cellular physiological and physiopathological processes. We have previously reported that PrPC participates in multi-drug-resistance of gastric cancer. As the salient ligand molecule
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU109791-20UG | 04061831358162 |
| EHU109791-50UG | 04061831374704 |