Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAAGCCCTGTCAAAGCAAGAGATGGCTAGTGCTTCATCCAGCCAAAGAGGTCGAAGTGGTTCTGGAAACTTTGGTGGTGGTCGTGGAGGTGGTTTCGGTGGGAATGACAACTTCGGTCGTGGAGGAAACTTCAGTGGTCGTGGTGGCTTTGGTGGCAGCCGTGGTGGTGGTGGATATGGTGGCAGTGGGGATGGCTATAATGGATTTGGTAATGATGGTGGTTATGGAGGAGGCGGCCCTGGTTACTCTGGAGGAAGCAGAGGCTATGGAAGTGGTGGACAGGGTTATGGAAACCAGGGCAGTGGCTATGGCGGGAGTGGCAGCTATGACAGCTATAACAACGGAGGCGGAGGCGGCTTTGGCGGTGGTAGTGGTAGCAATTTTGGAGGTGGTGGAAGCTAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... HNRNPA1(3178)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Cheng-Kai Chang et al.
PloS one, 12(11), e0188214-e0188214 (2017-11-18)
The viral ribonucleoprotein (vRNP) of influenza A virus is formed by virion RNA (vRNA), viral polymerase complex, and nucleoprotein (NP). The NP plays an important role in facilitating the replication and stabilization of viral RNA. To explore host factors that
Mariana D Mandler et al.
Nucleic acids research, 42(11), 7319-7329 (2014-05-06)
The selective RNA-binding protein quaking I (QKI) plays important roles in controlling alternative splicing (AS). Three QKI isoforms are broadly expressed, which display distinct nuclear-cytoplasmic distribution. However, molecular mechanisms by which QKI isoforms control AS, especially in distinct cell types
Mei-Ling Li et al.
Methods (San Diego, Calif.), 183, 13-20 (2020-02-23)
Enterovirus A71 (EV-A711) RNA contains an internal ribosomal entry site (IRES) to direct cap-independent translation. IRES-dependent translation requires the host's translation initiation factors and IRES-associated trans-acting factors (ITAFs). We previously showed that hnRNP A1, the mRNA stability factor HuR, and
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU111271-20UG | 04061831358391 |
| EHU111271-50UG | 04061831374797 |