Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGCAACGAGAAGCTAACCATGCAGAACCTCAACGACCGCCTGGCCTCCTACCTGGACAAGGTGCGCGCCCTGGAGGCGGCCAACGGCGAGCTAGAGGTGAAGATCCGCGACTGGTACCAGAAGCAGGGGCCTGGGCCCTCCCGCGACTACAGCCACTACTACACGACCATCCAGGACCTGCGGGACAAGATTCTTGGTGCCACCATTGAGAACTCCAGGATTGTCCTGCAGATCGACAATGCCCGTCTGGCTGCAGATGACTTCCGAACCAAGTTTGAGACGGAACAGGCTCTGCGCATGAGCGTGGAGGCCGACATCAACGGCCTGCGCAGGGTGCTGGATGAGCTGACCCTGGCCAGGACCGACCTGGAGATGCAGATCGAAGGCCTGAAGGAAGAGCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... KRT19(3880)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Takayuki Kawai et al.
Cancer medicine, 6(11), 2531-2540 (2017-10-02)
The current lack of an easily measurable surrogate marker of cancer stem cells (CSCs) prevents the clinical application of CSCs for hepatocellular carcinoma (HCC). We previously reported that keratin 19 (K19) is a novel HCC-CSC marker associated with transforming growth
Masato Takano et al.
BMC cancer, 16(1), 903-903 (2016-11-20)
Keratin (K) 19-positive hepatocellular carcinoma (HCC) is well known to have a higher malignant potential than K19-negative HCC: However, the molecular mechanisms involved in K19-mediated progression of HCC remain unclear. We attempted to clarify whether K19 directly affects cell survival
Tomoaki Ohtsuka et al.
Scientific reports, 6, 39557-39557 (2016-12-23)
HER2 is a receptor tyrosine kinase and its upregulation via activating mutations or amplification has been identified in some malignant tumors, including lung cancers. Because HER2 can be a therapeutic target in HER2-driven malignancies, it is important to understand the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU115601-20UG | 04061828564095 |
| EHU115601-50UG | 04061828328543 |