Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTGGTGCAAAGGATGAGTTGCACATTGTTGAAGCAGAGGCAATGAATTACGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAGCCAACGGTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAGCTGTGGAGGAAGATGCAGAGTCAGAAGATGAAGAGGAGGAGGATGTGAAACTCTTAAGTATATCTGGAAAGCGGTCTGCCCCTGGAGGTGGTAGCAAGGTTCCACAGAAAAAAGTAAAACTTGCTGCTGATGAAGATGATGACGATGATGATGAAGAGGATGATGATGAAGATGATGATGATGATGATTTTGATGATGAGGAAGCTGAAGAAAAAGCGCCAGTGAAGAAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... NPM1(4869)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Derek Hang-Cheong Cheung et al.
Scientific reports, 7, 43650-43650 (2017-03-04)
Telomerase activation and telomere maintenance are critical for cellular immortalization and transformation. PIN2/TERF1-interacting telomerase inhibitor 1 (PinX1) is a telomerase regulator and the aberrant expression of PinX1 causes telomere shortening. Identifying PinX1-interacting proteins is important for understanding telomere maintenance. We
Qing-Qing Wang et al.
Chinese journal of cancer, 30(12), 853-860 (2011-11-22)
Nucleophosmin/B23 (NPM) is a universally expressed nucleolar phosphoprotein that participates in proliferation, apoptosis, ribosome assembly, and centrosome duplication; however, the role of NPM in cell cycle regulation is not well characterized. We investigated the mechanism by which NPM is involved
Dan Li et al.
The American journal of Chinese medicine, 45(3), 599-614 (2017-04-08)
Abundant evidence supports the key role of ultraviolet radiation (UVR) in skin cancer development. The human skin, especially the epidermal layer, is the main defense against UV radiation. Baicalin is a major bioactive component of Scutellaria baicalensis Georgi, a plant
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU115611-20UG | 04061831345025 |
| EHU115611-50UG | 04061828328550 |