Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGTGCTCAGAGGTTCCACATCAACCTGTGCTCTGGGAACCACATCGCCTTCCACCTGAACCCCCGTTTTGATGAGAATGCTGTGGTCCGCAACACCCAGATCGACAACTCCTGGGGGTCTGAGGAGCGAAGTCTGCCCCGAAAAATGCCCTTCGTCCGTGGCCAGAGCTTCTCAGTGTGGATCTTGTGTGAAGCTCACTGCCTCAAGGTGGCCGTGGATGGTCAGCACCTGTTTGAATACTACCATCGCCTGAGGAACCTGCCCACCATCAACAGACTGGAAGTGGGGGGCGACATCCAGCTGACCCATGTGCAGACATAGGCGGCTTCCTGGCCCTGGGGCCGGGGGCTGGGGTGTGGGGCAGTCTGGGTCCTCTCATCATCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... LGALS9(3965)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Katrin Schaefer et al.
Glycobiology, 27(9), 878-887 (2017-08-16)
Changes in the T cell surface redox environment regulate critical cell functions, such as cell migration, viral entry and cytokine production. Cell surface protein disulfide isomerase (PDI) contributes to the regulation of T cell surface redox status. Cell surface PDI
Akira Nishio et al.
Hepatology (Baltimore, Md.), 65(1), 18-31 (2016-09-20)
Natural killer (NK) cell activation is associated with both liver injury and persistent infection in chronic hepatitis C (CHC); however, the detailed mechanism of this activation has not yet been fully elucidated. Because galectin-9 (Gal-9) has been reported to be
Ran Lv et al.
Molecular medicine reports, 16(6), 9111-9119 (2017-10-11)
Generally considered as a potent pro‑inflammatory signal, β‑galactosidelectin suppresses T cell receptor activation, can both promote and inhibit integrin‑mediated adhesion and is required in nuclear pre‑mRNA splicing. Galectin‑9 (Gal‑9), a member of β‑galactoside lectin, is involved many processes of T cell‑mediated
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU116291-50UG | 04061828304967 |
| EHU116291-20UG | 04061828537471 |