Sign In to View Organizational & Contract Pricing.
Select a Size
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAAGCAAGGCCCACAGACTACCCCACTCAAGAACAGCAGTTGCATTTTATTCGTCATTACCTGGCAGAGGCAAAGAAAGGTGAGACCCTCTCCCAAGAGGAGCAGAGAAAACTGGAAGAAGATTTGCTGGTAGAAGTCAGTCGGTATGCTCTGGCATCCCATTTCTTCTGGGGTCTGTGGTCCATCCTCCAGGCATCCATGTCCACCATAGAATTTGGTTACTTGGACTATGCCCAGTCTCGGTTCCAGTTCTACTTCCAGCAGAAGGGGCAGCTGACCAGTGTCCACTCCTCATCCTGACTCC
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
F Ye et al.
Cancer gene therapy, 21(5), 209-217 (2014-05-24)
Mammalian checkpoint kinases 1 and 2 (Chk1 and Chk2) are essential kinases that are involved in cell cycle checkpoint control, and the abrogation of either has been proposed as one way to sensitize cancer cells to DNA-damaging agents. However, it
Xiaoyun Yang et al.
Life sciences, 106(1-2), 12-18 (2014-04-22)
The checkpoint kinase 1 (Chk1) functions not only in genotoxic stresses but also in normal cell cycle progression, particularly in the initiation, progression and fidelity of unperturbed mitosis. In this study, we investigated the role of Chk1 in regulating the
Hui Ling et al.
Oncology reports, 32(5), 2274-2282 (2014-09-02)
Previous studies have shown that diallyl disulfide (DADS), a naturally occurring anticancer agent in garlic, arrested human gastric cancer cells (MGC803) in the G2/M phase of the cell cycle. Due to the importance of cell cycle redistribution in DADS-mediated anticarcinogenic
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service