Skip to Content
Merck
CN

EHU119391

MISSION® esiRNA

targeting human GPX4

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCACATGGTTAACCTGGACAAGTACCGGGGCTTCGTGTGCATCGTCACCAACGTGGCCTCCCAGTGAGGCAAGACCGAAGTAAACTACACTCAGCTCGTCGACCTGCACGCCCGATACGCTGAGTGTGGTTTGCGGATCCTGGCCTTCCCGTGTAACCAGTTCGGGAAGCAGGAGCCAGGGAGTAACGAAGAGATCAAAGAGTTCGCCGCGGGCTACAACGTCAAATTCGATATGTTCAGCAAGATCTGCGTGAACGGGGACGACGCCCACCCGCTGTGGAAGTGGATGAAGATCCAACCCAAGGGCAAGGGCATCCTGGGAAATGCCATCAAGTGGAACTTCACCAAGTTCCTCATCGACAAGAACGGCTGCGTGGTGAAGCGCTACGGACCCATGGAGGAGCCCCTGGTGATAGAGAAGGACCTGCCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

常规特殊物品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xuefei Zhang et al.
Journal of cellular physiology, 235(4), 3425-3437 (2019-09-27)
Glutathione peroxidase 4 (GPX4) has been confirmed to inhibit ferroptosis in cancer cells, however, whether GPX4 serves as an oncogene is not clear. In this study, the expression of GPX4 and its influence to survival of patients with cancer were
Zongqi Wang et al.
Cancer letters, 428, 21-33 (2018-04-28)
Ferroptosis is a form of programmed cell death decided by iron-dependent lipid peroxidation, but its role in glioma cell death remains unclear. In this study, we found Pseudolaric acid B (PAB) inhibited the viabilities of glioma cells in vitro and in vivo
Lisa Mayr et al.
Nature communications, 11(1), 1775-1775 (2020-04-15)
The increased incidence of inflammatory bowel disease (IBD) has become a global phenomenon that could be related to adoption of a Western life-style. Westernization of dietary habits is partly characterized by enrichment with the ω-6 polyunsaturated fatty acid (PUFA) arachidonic

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service