Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCACATGGTTAACCTGGACAAGTACCGGGGCTTCGTGTGCATCGTCACCAACGTGGCCTCCCAGTGAGGCAAGACCGAAGTAAACTACACTCAGCTCGTCGACCTGCACGCCCGATACGCTGAGTGTGGTTTGCGGATCCTGGCCTTCCCGTGTAACCAGTTCGGGAAGCAGGAGCCAGGGAGTAACGAAGAGATCAAAGAGTTCGCCGCGGGCTACAACGTCAAATTCGATATGTTCAGCAAGATCTGCGTGAACGGGGACGACGCCCACCCGCTGTGGAAGTGGATGAAGATCCAACCCAAGGGCAAGGGCATCCTGGGAAATGCCATCAAGTGGAACTTCACCAAGTTCCTCATCGACAAGAACGGCTGCGTGGTGAAGCGCTACGGACCCATGGAGGAGCCCCTGGTGATAGAGAAGGACCTGCCCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... GPX4(2879)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
常规特殊物品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xuefei Zhang et al.
Journal of cellular physiology, 235(4), 3425-3437 (2019-09-27)
Glutathione peroxidase 4 (GPX4) has been confirmed to inhibit ferroptosis in cancer cells, however, whether GPX4 serves as an oncogene is not clear. In this study, the expression of GPX4 and its influence to survival of patients with cancer were
Zongqi Wang et al.
Cancer letters, 428, 21-33 (2018-04-28)
Ferroptosis is a form of programmed cell death decided by iron-dependent lipid peroxidation, but its role in glioma cell death remains unclear. In this study, we found Pseudolaric acid B (PAB) inhibited the viabilities of glioma cells in vitro and in vivo
Lisa Mayr et al.
Nature communications, 11(1), 1775-1775 (2020-04-15)
The increased incidence of inflammatory bowel disease (IBD) has become a global phenomenon that could be related to adoption of a Western life-style. Westernization of dietary habits is partly characterized by enrichment with the ω-6 polyunsaturated fatty acid (PUFA) arachidonic
Global Trade Item Number
| SKU | GTIN |
|---|---|
| P39001-100G | 04061833553985 |
| P39001-5G | 04061833553992 |
| EHU119391-20UG | 04061828553228 |
| EHU119391-50UG | 04061831363562 |