Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCGAGATCCTCGAAGAATGGTGTCCCCACTTCGCCGATACACCCGCCACATATCCTTCACAGGGGACTTGGGAGTCTCTCCCTATAGTCCTGCCTACTTATCTCCTCCCCCAGAGTCTAGCTGGCGAAGGACGATGGCCTGGGGCAATTTCCCTGCAGAGAAGGGGCAGTTGTTTCGACTACCATCTGCACTTAACAGGACAAGCTCTGACTCTGCCCTTCATACAAGTGTGATGAACCCCAGTCCCCAGGATACCTACCCAGGCCCCACACCTCCCAGCATCCTGCCCAGCCGACGTGGGGGTATTCTGGATGGTGAAATGGACCCCAAAGTACCTGCTATTGAGGAGAACTTGCTAGATGACAAGCATTTGCTGAAGCCATGGGATGCTAAGAAGCTATCCTCATCCTCTTCCCGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CRTC2(200186)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xiao Zhi et al.
Liver transplantation : official publication of the American Association for the Study of Liver Diseases and the International Liver Transplantation Society, 23(9), 1186-1198 (2017-06-08)
Despite its rarity (1%-2%), acute graft-versus-host disease after liver transplantation (LT-aGVHD) has a high mortality rate (85%). A gradual decrease in regulatory T cells (Tregs) correlates with disease progression in a rat LT-GVHD model, and treatments which increase Tregs exert
Ali Rastegari et al.
Drug delivery and translational research, 9(3), 694-706 (2019-03-03)
Diabetes mellitus is a chronic metabolic disorder characterized by insulin deficiency and impaired glucose metabolism. Overexpression of cAMP response element binding protein (CREB)-regulated transcriptional coactivator 2 (CRTC2) plays an important role in high gluconeogenesis in patients with diabetes type II.
Laura Rodón et al.
Science advances, 5(7), eaaw6455-eaaw6455 (2019-07-30)
The LKB1 tumor suppressor is often mutationally inactivated in non-small cell lung cancer (NSCLC). LKB1 phosphorylates and activates members of the AMPK family of Ser/Thr kinases. Within this family, the salt-inducible kinases (SIKs) modulate gene expression in part via the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU120261-50UG | 04061828318438 |
| EHU120261-20UG | 04061828553969 |