Skip to Content
Merck
CN

EHU120261

MISSION® esiRNA

targeting human CRTC2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCGAGATCCTCGAAGAATGGTGTCCCCACTTCGCCGATACACCCGCCACATATCCTTCACAGGGGACTTGGGAGTCTCTCCCTATAGTCCTGCCTACTTATCTCCTCCCCCAGAGTCTAGCTGGCGAAGGACGATGGCCTGGGGCAATTTCCCTGCAGAGAAGGGGCAGTTGTTTCGACTACCATCTGCACTTAACAGGACAAGCTCTGACTCTGCCCTTCATACAAGTGTGATGAACCCCAGTCCCCAGGATACCTACCCAGGCCCCACACCTCCCAGCATCCTGCCCAGCCGACGTGGGGGTATTCTGGATGGTGAAATGGACCCCAAAGTACCTGCTATTGAGGAGAACTTGCTAGATGACAAGCATTTGCTGAAGCCATGGGATGCTAAGAAGCTATCCTCATCCTCTTCCCGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... CRTC2(200186)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiao Zhi et al.
Liver transplantation : official publication of the American Association for the Study of Liver Diseases and the International Liver Transplantation Society, 23(9), 1186-1198 (2017-06-08)
Despite its rarity (1%-2%), acute graft-versus-host disease after liver transplantation (LT-aGVHD) has a high mortality rate (85%). A gradual decrease in regulatory T cells (Tregs) correlates with disease progression in a rat LT-GVHD model, and treatments which increase Tregs exert
Ali Rastegari et al.
Drug delivery and translational research, 9(3), 694-706 (2019-03-03)
Diabetes mellitus is a chronic metabolic disorder characterized by insulin deficiency and impaired glucose metabolism. Overexpression of cAMP response element binding protein (CREB)-regulated transcriptional coactivator 2 (CRTC2) plays an important role in high gluconeogenesis in patients with diabetes type II.
Ping Li et al.
Journal of agricultural and food chemistry, 67(37), 10513-10520 (2019-09-03)
Amino acids can stimulate milk fat synthesis, but the underlying molecular mechanism is still largely unknown. In this study, we studied the regulatory role and corresponding molecular mechanism of cAMP response element-binding protein-regulated transcription coactivator 2 (CRTC2) in amino acid-induced
Laura Rodón et al.
Science advances, 5(7), eaaw6455-eaaw6455 (2019-07-30)
The LKB1 tumor suppressor is often mutationally inactivated in non-small cell lung cancer (NSCLC). LKB1 phosphorylates and activates members of the AMPK family of Ser/Thr kinases. Within this family, the salt-inducible kinases (SIKs) modulate gene expression in part via the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service