Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAAGACCTGCCTTCTCATCAGCTACACCACCAACGCCTTTCCCGGAGAGTACATCCCCACCGTGTTTGACAACTATTCAGCCAATGTGATGGTGGACAGCAAGCCAGTGAACCTGGGGCTGTGGGACACTGCTGGGCAGGAGGACTACGACCGTCTCCGGCCGCTCTCCTATCCACAGACGGACGTCTTCCTCATCTGCTTCTCCCTCGTCAGCCCAGCCTCTTATGAGAACGTCCGCGCCAAGTGGTTCCCAGAAGTGCGGCACCACTGCCCCAGCACACCCATCATCCTGGTGGGCACCAAGCTGGACCTGCGGGACGACAAGGACACCATCGAGAAACTGAAGGAGAAGAAGCTGGCTCCCATCACCTACCCGCAGGGCCTGGCACTGGCCAAGGAGATTGACTCGGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RAC2(5880)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hailong Pei et al.
Cell cycle (Georgetown, Tex.), 16(1), 113-122 (2016-12-10)
Our recent study showed that quiescent G0 cells are more resistant to ionizing radiation than G1 cells; however, the underlying mechanism for this increased radioresistance is unknown. Based on the relatively lower DNA damage induced in G0 cells, we hypothesize
Xu Zhang et al.
Cancer medicine, 8(12), 5716-5734 (2019-08-08)
The aim of this study is to investigate the functions and mechanisms of miR-608 in prostate cancer (PCa). CISH and qRT-PCR analysis demonstrated that miR-608 was low expressed in PCa tissues and cells, which was partly attributed to the methylation
Peng Xia et al.
International journal of biological macromolecules, 137, 1221-1231 (2019-07-07)
Osteosarcoma (OS) is the most common primary malignancy of bone and is characterized by a high malignant and metastatic potential. Microarray-based differentially expressed gene screening determined RAC2 as the candidate gene related to OS. Highly expressed RAC2 and activated Wnt
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU120691-50UG | 04061828346554 |
| EHU120691-20UG | 04061831359046 |