Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGCAACATCCTTGTCAACAGCAACCTGGTCTGCAAAGTCTCAGACTTTGGCCTCTCCCGCTTCCTGGAGGATGACCCCTCCGATCCTACCTACACCAGTTCCCTGGGCGGGAAGATCCCCATCCGCTGGACTGCCCCAGAGGCCATAGCCTATCGGAAGTTCACTTCTGCTAGTGATGTCTGGAGCTACGGAATTGTCATGTGGGAGGTCATGAGCTATGGAGAGCGACCCTACTGGGACATGAGCAACCAGGATGTCATCAATGCCGTGGAGCAGGATTACCGGCTGCCACCACCCATGGACTGTCCCACAGCACTGCACCAGCTCATGCTGGACTGCTGGGTGCGGGACCGGAACCTCAGGCCCAAATTCTCCCAGATTGTCAATACCCTGGACAAGCTCATCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... EPHB3(2049)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Bo Gun Jang et al.
Biomolecules, 10(4) (2020-04-17)
The protein tyrosine kinase Ephrin type-B receptor 3 (EPHB3) is expressed in cells at the base of intestinal crypts, acting as a cellular guide in the maintenance of intestinal crypt architecture. We aimed to investigate the expression profile of EPHB3
Guodong Zhang et al.
Cancer science, 108(3), 408-418 (2017-04-04)
microRNAs play key roles during various crucial cell processes such as proliferation, migration, invasion and apoptosis. Also, microRNAs have been shown to possess oncogenic and tumor-suppressive functions in human cancers. Here, we describe the regulation and function of miR-149 in
Seong Hye Park et al.
Theranostics, 9(8), 2235-2251 (2019-06-01)
A major problem of colorectal cancer (CRC) targeted therapies is relapse caused by drug resistance. In most cases of CRC, patients develop resistance to anticancer drugs. Cetuximab does not show many of the side effects of other anticancer drugs and
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU121451-20UG | 04061828582044 |
| EHU121451-50UG | 04061828347261 |