Skip to Content
Merck
CN

EHU123751

MISSION® esiRNA

targeting human CLDN5

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGGCTCCTCGGAACGTCCGGCTCTGCGCCCCGACGCGGCTCCTGGATCCGCTCCTGCCTGCGCCCGCAGCTGACCTTCTCCTGCCACTAGCCCGGCCCTGCCCTTAACAGACGGAATGAAGTTTCCTTTTCTGTGCGCGGCGCTGTTTCCATAGGCAGAGCGGGTGTCAGACTGAGGATTTCGCTTCCCCTCCAAGACGCTGGGGGTCTTGGCTGCTGCCTTACTTCCCAGAGGCTCCTGCTGACTTCGGAGGGGCGGATGCAGAGCCCAGGGCCCCCACCGGAAGATGTGTACAGCTGGTCTTTACTCCATCGGCAGGGCCCGAGCCCAGGGACCAGTGACTTGGCCTGGACCTCCCGGTCTCACTCCAGCATCTCCCCAGGCAAGGCTTGTGGGCACCGGAGCTTGAGAGAGGGCGGGAGTGGGAAGGCTAAGAATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yanan Jia et al.
American journal of translational research, 11(9), 5546-5559 (2019-10-22)
The combination of anti-angiogenesis and chemotherapy can significantly prolong the survival period of patients with non-squamous non-small cell lung cancer (NSCLC). But drug resistance will inevitably occur, thereby causing increased tumor invasion and metastasis. Claudin-5 (CLDN5) is a protein member
Christine M Gross et al.
American journal of respiratory cell and molecular biology, 58(5), 614-624 (2017-11-09)
One of the early events in the progression of LPS-mediated acute lung injury in mice is the disruption of the pulmonary endothelial barrier resulting in lung edema. However, the molecular mechanisms by which the endothelial barrier becomes compromised remain unresolved.
Natalie Hudson et al.
JCI insight, 4(15) (2019-08-09)
Age-related macular degeneration (AMD) is the leading cause of central retinal vision loss worldwide, with an estimated 1 in 10 people over the age of 55 showing early signs of the condition. There are currently no forms of therapy available

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service