EHU125091
MISSION® esiRNA
targeting human RNF6
Sign Into View Organizational & Contract Pricing
Select a Size
About This Item
UNSPSC Code:
41105324
NACRES:
NA.51
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATGGTGGCAGTGAAGAAACCTTACCTCAAGACCATAATCATCATGAAAATGAGAGAAGATGGCAGCAAGAGCGTCTCCACAGAGAAGAGGCCTATTATCAGTTTATTAATGAACTCAATGATGAAGATTATCGGCTTATGAGAGACCATAATCTTTTAGGCACCCCTGGAGAAATAACATCAGAAGAACTGCAACAGCGGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RNF6(6049), RNF6(6049)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jiyu Miao et al.
Anti-cancer drugs, 31(6), 583-591 (2020-04-14)
Colorectal cancer (CRC) is one of most common cancers worldwide. Although miR-203a is reported as a tumor suppressor involved in cell progression in some cancers, the role of miR-203a in CRC is still controversial and the underling mechanism of miR-203a
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service