Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGTGGGTGAGATCATGTGGGGCTACAAGGACCCCCTTGTGAATCTCATCAACAAGTACTTTCCAGGCATGTTCCCCTTCAAGGACAAGTTCGGATTATTTGCTGAGCTCAACAACTCCGACTCTGGGCTCTTCACGGTGTTCACGGGGGTCCAGAACATCAGCAGGATCCACCTCGTGGACAAGTGGAACGGGCTGAGCAAGGTTGACTTCTGGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SCARB1(949)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ilaria Crivellari et al.
Free radical biology & medicine, 102, 47-56 (2016-11-21)
For its critical location, the skin represents the major interface between the body and the environment, therefore is one of the major biological barriers against the outdoor environmental stressors. Among the several oxidative environmental stressors, cigarette smoke (CS) has been
Rene Raphemot et al.
Cell chemical biology, 26(9), 1253-1262 (2019-07-02)
Plasmodium parasites undergo an obligatory and asymptomatic developmental stage within the liver before infecting red blood cells to cause malaria. The hijacked host pathways critical to parasite infection during this hepatic phase remain poorly understood. Here, we implemented a forward
Vasily Sukhorukov et al.
Biochimica et biophysica acta. Molecular and cell biology of lipids, 1864(5), 643-653 (2019-01-15)
Human plasma lipoproteins are known to contain various glycan structures whose composition and functional importance are starting to be recognized. We assessed N-glycosylation of human plasma HDL and LDL and the role of their glycomes in cellular cholesterol metabolism. N-glycomic
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU125211-20UG | 04061831359701 |
| EHU125211-50UG | 04061831375190 |