EHU125211
MISSION® esiRNA
targeting human SCARB1
Sign Into View Organizational & Contract Pricing
Select a Size
About This Item
UNSPSC Code:
41105324
NACRES:
NA.51
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGTGGGTGAGATCATGTGGGGCTACAAGGACCCCCTTGTGAATCTCATCAACAAGTACTTTCCAGGCATGTTCCCCTTCAAGGACAAGTTCGGATTATTTGCTGAGCTCAACAACTCCGACTCTGGGCTCTTCACGGTGTTCACGGGGGTCCAGAACATCAGCAGGATCCACCTCGTGGACAAGTGGAACGGGCTGAGCAAGGTTGACTTCTGGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SCARB1(949), SCARB1(949)
Related Categories
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ilaria Crivellari et al.
Free radical biology & medicine, 102, 47-56 (2016-11-21)
For its critical location, the skin represents the major interface between the body and the environment, therefore is one of the major biological barriers against the outdoor environmental stressors. Among the several oxidative environmental stressors, cigarette smoke (CS) has been
Vasily Sukhorukov et al.
Biochimica et biophysica acta. Molecular and cell biology of lipids, 1864(5), 643-653 (2019-01-15)
Human plasma lipoproteins are known to contain various glycan structures whose composition and functional importance are starting to be recognized. We assessed N-glycosylation of human plasma HDL and LDL and the role of their glycomes in cellular cholesterol metabolism. N-glycomic
Rene Raphemot et al.
Cell chemical biology, 26(9), 1253-1262 (2019-07-02)
Plasmodium parasites undergo an obligatory and asymptomatic developmental stage within the liver before infecting red blood cells to cause malaria. The hijacked host pathways critical to parasite infection during this hepatic phase remain poorly understood. Here, we implemented a forward
Alain Lescoat et al.
Frontiers in immunology, 11, 219-219 (2020-03-07)
Inhalation of crystalline silica (SiO2) is a risk factor of systemic autoimmune diseases such as systemic sclerosis (SSc) and fibrotic pulmonary disorders such as silicosis. A defect of apoptotic cell clearance (i.e., efferocytosis, a key process in the resolution of
Zhou-Yi Wu et al.
European journal of pharmacology, 853, 111-120 (2019-03-25)
Farnesoid X receptor (FXR) agonists play important regulatory roles in bile acid, lipid and glucose metabolism in vitro and in vivo. Thus, FXR agonists exhibit potential therapeutic effects on metabolism-related diseases that are associated with extrahepatic manifestations induced by hepatitis
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service