Sign In to View Organizational & Contract Pricing.
Select a Size
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTTGCCATCGATGCTCTACAGTTATGTTGTTTGTTACTTCCCCCACCAAATCGTAGAAAGCTTCAACTTTTAATGCGTATGATTTCCCGAATGAGTCAAAATGTTGATATGCCCAAACTTCATGATGCAATGGGTACGAGGTCACTGATGATACATACCTTTTCTCGATGTGTGTTATGCTGTGCTGAAGAAGTGGATCTTGATGAGCTTCTTGCTGGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
Related Categories
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Anna Tosi et al.
Oncoimmunology, 6(8), e1313371-e1313371 (2017-09-19)
The identification of universal tumor-specific antigens shared between multiple patients and/or multiple tumors is of great importance to overcome the practical limitations of personalized cancer immunotherapy. Recent studies support the involvement of DEPDC1 in many aspects of cancer traits, such
Alboukadel Kassambara et al.
PloS one, 8(4), e62752-e62752 (2013-05-07)
High throughput DNA microarray has made it possible to outline genes whose expression in malignant plasma cells is associated with short overall survival of patients with Multiple Myeloma (MM). A further step is to elucidate the mechanisms encoded by these
Ryogo Kikuchi et al.
Journal of neuro-oncology, 133(2), 297-307 (2017-05-31)
DEP domain containing 1 (DEPDC1) is a novel oncoantigen expressed in cancer cells, which presents oncogenic activity and high immunogenicity. Although DEPDC1 has been predicted to be a useful antigen for the development of a cancer vaccine, its pathophysiological roles
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service