Skip to Content
Merck
CN

EHU130111

Sigma-Aldrich

MISSION® esiRNA

targeting human CTCF

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACAGCAGGAGGGTCTGCTATCAGAGGTTAATGCAGAGAAAGTGGTTGGTAATATGAAGCCTCCAAAGCCAACAAAAATTAAAAAGAAAGGTGTAAAGAAGACATTCCAGTGTGAGCTTTGCAGTTACACGTGTCCACGGCGTTCAAATTTGGATCGTCACATGAAAAGCCACACTGATGAGAGACCACACAAGTGCCATCTCTGTGGCAGGGCATTCAGAACAGTCACCCTCCTGAGGAATCACCTTAACACACACACAGGTACTCGTCCTCACAAGTGCCCAGACTGCGACATGGCCTTTGTGACCAGTGGAGAATTGGTTCGGCATCGTCGTTACAAACACACCCACGAGAAGCCATTCAAGTGTTCCATGTGCGATTACGCCAGTGTAGAAGTCAGCAAATTAAAACGTCACATTCGCTCTCATACTGGAGAGCGTCCGTTTCAGTGCAGTTTGTGCAGTTATGCCAGCAGGGACACATACAAGCTGAAAAGGCACATGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

常规特殊物品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tommy W Terooatea et al.
Nucleic acids research, 44(21), e159-e159 (2016-08-24)
Recently, a number of advances have been implemented into the core ChIP-seq (chromatin immunoprecipitation coupled with next-generation sequencing) methodology to streamline the process, reduce costs or improve data resolution. Several of these emerging ChIP-based methods perform additional chemical steps on
Li Sun et al.
Theranostics, 10(26), 11950-11962 (2020-11-19)
Rationale: Mesenchymal stem cells (MSCs) have been the focus of many studies because of their abilities to modulate immune responses, angiogenesis, and promote tumor growth and metastasis. Our previous work showed that gastric cancer MSCs (GCMSCs) promoted immune escape by
Nathan A Damaschke et al.
Clinical epigenetics, 12(1), 80-80 (2020-06-07)
The chromatin insulator CCCTC-binding factor (CTCF) displays tissue-specific DNA binding sites that regulate transcription and chromatin organization. Despite evidence linking CTCF to the protection of epigenetic states through barrier insulation, the impact of CTCF loss on genome-wide DNA methylation sites
Francisco Puerta Martínez et al.
Journal of virology, 88(13), 7389-7401 (2014-04-18)
Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA
Han Zhou et al.
JCI insight, 5(3) (2020-02-14)
Vascular inflammation is present in many cardiovascular diseases, and exogenous glucocorticoids have traditionally been used as a therapy to suppress inflammation. However, recent data have shown that endogenous glucocorticoids, acting through the endothelial glucocorticoid receptor, act as negative regulators of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service