Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGAATGGGACCCCAATGTATCTCTATGAAGTGGCCACGGAGTCGGTGTGTGAATCAGCTGCCAGACTTCTCTTCATGAGCATCAAGTGGGCTAAGAGTGTGCCAGCCTTCTCCACGCTGTCTTTGCAAGACCAGCTGATGCTTTTGGAAGATGCTTGGAGAGAACTGTTTGTTCTAGGAATAGCACAATGGGCCATTCCGGTTGATGCTAACACTCTACTGGCTGTATCTGGCATGAACGGTGACAACACAGATTCCCAGAAGCTGAACAAGATCATATCTGAAATACAGGCTTTACAAGAGGTGGTGGCTCGATTTAGACAACTCCGGTTAGATGCTACTGAATTTGCCTGTCTAAAATGCATCGTCACTTTCAAAGCCGTTCCTACACATAGTGGTTCTGAACTGAGAAGTTTCCGGAATGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... NR2E1(7101)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Meng-Lay Lin et al.
Oncotarget, 6(25), 21685-21703 (2015-08-19)
The Nuclear Receptor (NR) superfamily of transcription factors comprises 48 members, several of which have been implicated in breast cancer. Most important is estrogen receptor-α (ERα), which is a key therapeutic target. ERα action is facilitated by co-operativity with other
Kristine Griffett et al.
Cell chemical biology, 27(10), 1272-1284 (2020-08-09)
TLX is an orphan nuclear receptor that plays a critical role in both embryonic and adult neurogenesis, as well in the pathogenesis of glioblastomas. TLX functions predominately as a transcriptional repressor, but no natural ligands or high-affinity synthetic ligands have
J Song et al.
Cell death & disease, 6, e1844-e1844 (2015-08-08)
In the central nervous system (CNS), hyperglycemia leads to neuronal damage and cognitive decline. Recent research has focused on revealing alterations in the brain in hyperglycemia and finding therapeutic solutions for alleviating the hyperglycemia-induced cognitive dysfunction. Adiponectin is a protein
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU130251-20UG | 04061828682430 |
| EHU130251-50UG | 04061828457229 |