Skip to Content
Merck
CN

EHU130251

MISSION® esiRNA

targeting human NR2E1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human NR2E1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAATGGGACCCCAATGTATCTCTATGAAGTGGCCACGGAGTCGGTGTGTGAATCAGCTGCCAGACTTCTCTTCATGAGCATCAAGTGGGCTAAGAGTGTGCCAGCCTTCTCCACGCTGTCTTTGCAAGACCAGCTGATGCTTTTGGAAGATGCTTGGAGAGAACTGTTTGTTCTAGGAATAGCACAATGGGCCATTCCGGTTGATGCTAACACTCTACTGGCTGTATCTGGCATGAACGGTGACAACACAGATTCCCAGAAGCTGAACAAGATCATATCTGAAATACAGGCTTTACAAGAGGTGGTGGCTCGATTTAGACAACTCCGGTTAGATGCTACTGAATTTGCCTGTCTAAAATGCATCGTCACTTTCAAAGCCGTTCCTACACATAGTGGTTCTGAACTGAGAAGTTTCCGGAATGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Meng-Lay Lin et al.
Oncotarget, 6(25), 21685-21703 (2015-08-19)
The Nuclear Receptor (NR) superfamily of transcription factors comprises 48 members, several of which have been implicated in breast cancer. Most important is estrogen receptor-α (ERα), which is a key therapeutic target. ERα action is facilitated by co-operativity with other
Kristine Griffett et al.
Cell chemical biology, 27(10), 1272-1284 (2020-08-09)
TLX is an orphan nuclear receptor that plays a critical role in both embryonic and adult neurogenesis, as well in the pathogenesis of glioblastomas. TLX functions predominately as a transcriptional repressor, but no natural ligands or high-affinity synthetic ligands have
J Song et al.
Cell death & disease, 6, e1844-e1844 (2015-08-08)
In the central nervous system (CNS), hyperglycemia leads to neuronal damage and cognitive decline. Recent research has focused on revealing alterations in the brain in hyperglycemia and finding therapeutic solutions for alleviating the hyperglycemia-induced cognitive dysfunction. Adiponectin is a protein

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service