Skip to Content
Merck
CN

EHU130841

Sigma-Aldrich

MISSION® esiRNA

targeting human DLEU1

Sign Into View Organizational & Contract Pricing

Select a Size

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACGGGTCCTGCTTAGGAGAAAAGAAAAACGTCTTACAGCCAGTGTCTAAACTCCAAACAACGGAATGTATCAATGAGACCTTGTATATGGATACACGTGCATTTAAAACCGCCCTGCCGGCTTGTAGAGCTTTTGCCGTTCTCCAGCGCTTTACAGGGGTTATCGCACTTAAGCCTCGGAACAACTTTACCAGTGATTCTACCAGAAAGGAATGAAGAACAGAACCTTCAGGAATTGAGTCACAATGCAGACAAATATCAAATGGGAGATTGTTGCAAGGAAGAGATTGATGATAGTATTTTCTACTAGCCATTGGGAAGATAAAAGGAGACAGAAGATTGAAGCCTTTGCCAGCCATTCTTTCCCTTTTTGCTTCCAAACTCCTCAACTGGGAACCTTCATATGTGCAGTATTTATATTGGATCATACTGGTGATTATAAAAGTTCCTAGGAGGCTAGAAGAGCCAACCAACAGAGAAGGGAA

Ensembl | human accession no.

ENSG00000176124

NCBI accession no.

NR_002605

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DLEU1(10301)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
WTU
QCS

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hangbo Li et al.
OncoTargets and therapy, 13, 2037-2045 (2020-03-28)
Cisplatin (DDP) resistance has become an obstacle to chemotherapy for nasopharyngeal carcinoma (NPC) patients. Recent evidences indicate that long noncoding RNAs (lncRNAs) are involved in tumorigenesis and chemoresistance. However, the potential role of lncRNAs in NPC progression remains largely unknown.
Wei Liu et al.
Cell biochemistry and function, 38(7), 886-894 (2020-03-21)
According to statistics, abnormal regulation of lncRNAs pivotally influences multiple malignant tumours. DLEU2, as one of these lncRNAs, is detected to be related to growth and development of tumours. The molecular mechanisms of DLEU2 in osteosarcoma, however, are still unknown.
Li Feng et al.
OncoTargets and therapy, 12, 5405-5414 (2019-07-31)
Long noncoding RNA (lncRNA) deleted in lymphocytic leukemia 1 (DLEU1) was reported to be involved in the development and progression of multiple cancers. However, the accurate expression pattern, biological function and potential molecular mechanism of DLEU1 in glioma are not
Song Gao et al.
Journal of cellular physiology, 234(5), 6746-6757 (2018-11-02)
Recent evidence has highlighted that long noncoding RNAs (lncRNA) are associated with many diseases, particularly cancer. However, current understanding of the lncRNA deleted in lymphocytic leukemia 1 (DLEU1) in pancreatic ductal adenocarcinoma (PDAC) remains limited. Our studies indicated that the
Shitao Zhang et al.
IUBMB life, 72(8), 1747-1756 (2020-05-26)
Increasing findings are suggesting the vital roles of long noncoding RNAs (lncRNAs) in the glioblastoma tumorigenesis. However, whether the novel lncRNA LINC00021 modulates temozolomide (TMZ) resistance of glioblastoma is still unclear. Clinically, lncRNA LINC00021 was significantly up-regulated in glioblastoma, especially
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service