Skip to Content
Merck
CN

EHU130921

MISSION® esiRNA

targeting human TGFBI

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCACCAACAACATCCAGCAGATCATTGAGATCGAGGACACCTTTGAGACCCTTCGGGCTGCTGTGGCTGCATCAGGGCTCAACACGATGCTTGAAGGTAACGGCCAGTACACGCTTTTGGCCCCGACCAATGAGGCCTTCGAGAAGATCCCTAGTGAGACTTTGAACCGTATCCTGGGCGACCCAGAAGCCCTGAGAGACCTGCTGAACAACCACATCTTGAAGTCAGCTATGTGTGCTGAAGCCATCGTTGCGGGGCTGTCTGTAGAGACCCTGGAGGGCACGACACTGGAGGTGGGCTGCAGCGGGGACATGCTCACTATCAACGGGAAGGCGATCATCTCCAATAAAGACATCCTAGCCACCAACGGGGTGATCCACTACATTGATGAGCTACTCATCCCAGACTCAGCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Huan He et al.
Oncogene, 37(19), 2586-2600 (2018-02-23)
A critical mechanism that has been proposed for transcription regulation by estrogen receptor α (ER) is the tethering of ER to DNA via other transcription factors, such as AP-1. However, genome-wide assessment of the overlap in chromatin binding repertoires of
Tianhong Pan et al.
Neoplasia (New York, N.Y.), 20(1), 32-43 (2017-12-01)
Bone metastasis is common in renal cell carcinoma (RCC), and the lesions are mainly osteolytic. The mechanism of bone destruction in RCC bone metastasis is unknown. We used a direct intrafemur injection of mice with bone-derived 786-O RCC cells (Bo-786)
Bingyan Li et al.
BMC cancer, 12, 239-239 (2012-06-15)
Transforming growth factor β induced (TGFBI) product, an extracellular matrix (ECM) protein, has been implicated as a putative tumor suppressor in recent studies. Our previous findings revealed that expression of TGFBI gene is down-regulated in a variety of cancer cell

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service