Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCATAGCCGAGTGTGAGACCCGGCTGGGCAAGCAGGGCCGGCGAGTCGTGGTCATCACCCAGAACATCGATGAGCTGCACCGCAAGGCTGGCACCAAGAACCTTCTGGAGATCCATGGTAGCTTATTTAAAACTCGATGTACCTCTTGTGGAGTTGTGGCTGAGAATTACAAGAGTCCAATTTGTCCAGCTTTATCAGGAAAAGGTGCTCCAGAACCTGGAACTCAAGATGCCAGCATCCCAGTTGAGAAACTTCCCCGGTGTGAAGAGGCAGGCTGCGGGGGCTTGCTGCGACCTCACGTCGTGTGGTTTGGAGAAAACCTGGATCCTGCCATTCTGGAGGAGGTTGACAGAGAGCTCGCCCACTGTGATTTATGTCTAGTGGTGGGCACTTCCTCTGTGGTGTACCCAGCAGCCATGTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SIRT5(23408)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Shan Dang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 106, 966-975 (2018-09-02)
Hepatocellular carcinoma(HCC) is one of the most common cancers in the world, with the characteristics of high morbidity and mortality. Though the levels of diagnosis and treatment of HCC have been largely improved recently, the prognosis of these patients remains
Ratana Lim et al.
Biology of reproduction, 95(5), 95-95 (2016-11-05)
Preterm birth remains the major cause of neonatal mortality and morbidity, mediated largely by an inflammatory process. The sirtuin (SIRT) family of cellular regulators has been implicated as key inhibitors of inflammation. We have previously reported a role for SIRT1
Yuping Yin et al.
Molecular cancer therapeutics, 18(8), 1439-1450 (2019-05-31)
DNA replication and repair proteins play an important role in cancer initiation and progression by affecting genomic instability. The DNA endonuclease Mus81 is a DNA structure-specific endonuclease, which has been implicated in DNA replication and repair. In this study, we
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU132521-50UG | 04061831375466 |
| EHU132521-20UG | 04061828684236 |