Skip to Content
Merck
CN

EHU135311

MISSION® esiRNA

targeting human DLG1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGACCTATGAAAGACAGGATAAATGATGACTTGATCTCAGAATTTCCTGACAAATTTGGATCCTGTGTTCCTCATACAACTAGACCAAAACGAGATTATGAGGTAGATGGAAGAGATTATCATTTTGTGACTTCAAGAGAGCAGATGGAAAAAGATATCCAGGAACATAAATTCATTGAAGCTGGCCAGTATAACAATCATCTATATGGAACAAGTGTTCAGTCTGTACGAGAAGTAGCAGAAAAGGGCAAACACTGTATCCTTGATGTGTCTGGAAATGCCATAAAGAGATTACAGATTGCACAGCTTTACCCTATCTCCATTTTTATTAAACCCAAATCCATGGAAAATATCATGGAAATGAATAAGCGTCTAACAGAAGAACAAGCCAGAAAAACATTTGAGAGAGCCATGAAACTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem/physiol Actions

DLG1 (disks large homolog 1) is a postsynaptic density protein. It is associated with the trafficking of GluA1 subunit of the glutamate receptor into synapses. It is also required for organizing brain circuitry. DLG1 is linked with neuropsychiatric disorders. It negatively controls the Wnt/β-catenin signaling pathway. It also participates in cell polarity and proliferation.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Opposing actions of the synapse-associated protein of 97-kDa molecular weight (SAP97) and Disrupted in Schizophrenia 1 (DISC1) on Wnt/?-catenin signaling.
Boccitto M
Neuroscience, 326, 22-22 (2016)
Mohammed M Nooh et al.
American journal of physiology. Renal physiology, 317(2), F375-F387 (2019-05-30)
Arginine-vasopressin (AVP)-mediated translocation of aquaporin-2 (AQP2) protein-forming water channels from storage vesicles to the membrane of renal collecting ducts is critical for the renal conservation of water. The type-1 PDZ-binding motif (PBM) in AQP2, "GTKA," is a critical barcode for
DLG1 polarity protein expression associates with the disease progress of low-grade cervical intraepithelial lesions.
Cavatorta AL
Experimental and Molecular Pathology, 102, 65-65 (2017)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service