Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCTTCCCTCCTGTTCTCTGGTTATAGCTGGTCCCAGGTCAGCGTGGGAGGCACCTTTGGGTTCCCAGTGCCCAGCACTTTGTAGTCTCATCCCAGATTACTAACCCTTCCTGATCCTGGAGAGGCAGGGATAGTAAATAAATTGCTCTTCCTACCCCATCCCCCATCCCCTGACAAAAAGTGACGGCAGCCGTACTGAGTCTGTAAGGCCCAAAGTGGGTACAGACAGCCTGGGCTGGTAAAAGTAGGTCCTTATTTACAAGGCTGCGTTAAAGTTGTACTAGGCAAACACACTGATGTAGGAAGCACGAGGAAAGGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RUNX3(864)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jikui Sun et al.
Oncotarget, 8(67), 110785-110796 (2018-01-18)
Accumulating data demonstrates that the network dysregulation of microRNA-medicated target genes is involved in glioma. We have previously found miR-19a/b overexpression in glioma cell lines and specimens with various tumour grades. However, there was no report on the function and
Lin Shi et al.
Cell stress & chaperones, 25(5), 793-802 (2020-07-19)
Lung toxicity is the main cause of the death from methamphetamine (MA) abuse, but its mechanism has remained unclear. The purpose of our study was to investigate if MA can induce epithelial-to-mesenchymal transition (EMT) and if RUNX3 is involved in
Bufeng Zhuang et al.
Molecular medicine reports, 19(5), 3933-3940 (2019-03-01)
Dysregulated microRNAs (miRNAs/miRs) directly modulate the biological functions of non‑small cell lung cancer (NSCLC) cells and contribute to the initiation and progression of NSCLC; however, the specific roles and underlying mechanisms of the dysregulated miRNAs in NSCLC require further investigation.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU135581-20UG | 04061831364651 |
| EHU135581-50UG | 04061828421619 |