Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACCATCTACTGCCAGGCATCGGAGGAGTTCCTGAACGGCAGGGCAGTATACAGCCCCAAGAGCCCCTCGCTACAGTCCGAGACCGTCCACTACAAGAGAGGGGTGAGCCAGCAGTTCTCCCTGCCCTCCTTCAAGATTGACTTCTCGGAATGGAAGGATGACGAGCTGAACTTTGACCTGGACCGGGGCGTGTTTCCAGTAGTCATCCAGGCTGTGGTGGACGAAGGAGATGTGGTGGAAGTGACTGGCCACGCCCACGTGCTCTTGGCTGCCTTTGAAAAGCACATGGACGGCAGCTTCTCTGTGAAGCCTTTAAAGCAGAAGCAAATTGTGGACCGGGTCAGCTACCTCCTGCAGGAGATCTATGGCATTGAGAACAAGAACAACCAGGAGACCAAGCCCTCGGACGACGAGAACAGCGACAACAGCAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MGRN1(23295)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Guan Sun et al.
Neuromolecular medicine, 21(1), 33-41 (2019-01-05)
Heat shock cognate protein 70 (Hsc70) is a key mediator for the maintenance of intracellular proteins and regulates cellular activities. And it is elevated in various tumor tissues including glioma, which is closely related to the malignancy and poor prognosis
Min Deng et al.
Molecular medicine reports, 20(1), 368-374 (2019-05-23)
The activation of hepatic stellate cells (HSCs) is considered associated with liver fibrosis. However, the exact role of syndecan‑1 (SDC1), a protein that regulates the interaction between cells and the microenvironment, in the activation of HSCs resulting in liver fibrosis
Hao Gao et al.
Cell cycle (Georgetown, Tex.), 18(12), 1393-1406 (2019-05-28)
Epithelial ovarian cancer (EOC) is the most lethal gynecologic malignancy, and its vulnerability to metastasis contributes to the poor outcomes of EOC patients. Long noncoding RNAs (lncRNAs) were verified to play a pivotal role in EOC metastasis. However, the potential
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU138301-20UG | 04061828636631 |
| EHU138301-50UG | 04061828411559 |