Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCAAATATGCCCACTTGAATATGGATCTGCATGTCTTCATTGAAGTCTTTGGACCCCCATGTGAGGCTTATGCTCTTATGGCCCATGCCATGGAGGAAGTCAAGAAATTTCTAGTACCGGATATGATGGATGATATCTGTCAGGAGCAATTTCTAGAGCTGTCCTACTTGAATGGAGTACCTGAACCCTCTCGTGGACGTGGGGTGCCAGTGAGAGGCCGGGGAGCTGCACCTCCTCCACCACCTGTTCCCAGGGGCCGTGGTGTTGGACCACCTCGGGGGGCTTTGGTACGTGGTACACCAGTAAGGGGAGCCATCACCAGAGGTGCCACTGTGACTCGAGGCGTGCCACCCCCACCTACTGTGAGGGGTGCTCCAGCACCAAGAGCACGGACAGCGGGCATCCAGAGGATACCTTTGCCTCCACCTCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... KHDRBS1(10657)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Shasha Tao et al.
Environmental toxicology, 34(5), 594-609 (2019-01-31)
Fine particulate matter is a well-known air pollutant threatening public health. Studies have confirmed long-term exposure to the particles could decrease the pulmonary function, induce asthma exacerbation, and chronic obstructive pulmonary disease, as well as increase the incidence and mortality
Teresa Vilariño-García et al.
Endocrine connections, 9(6), 479-488 (2020-05-07)
Polycystic ovary syndrome (PCOS) is a complex metabolic disorder associated with ovulatory dysfunction, hyperandrogenism, obesity, and insulin resistance, that leads to subfertility. Sam68 is an RNA-binding protein with signaling functions that is ubiquitously expressed, including gonads. Sam68 is recruited to
Hua Zhang et al.
Journal of virology, 89(19), 10031-10043 (2015-07-24)
Enterovirus 71 (EV71) recruits various cellular factors to assist in the replication and translation of its genome. Identification of the host factors involved in the EV71 life cycle not only will enable a better understanding of the infection mechanism but
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU140681-50UG | 04061828413829 |
| EHU140681-20UG | 04061828638710 |