Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGTGAGGACCATGCAAGCCCGAGGCTTCGGCTCGGATCAGTCCGAGAATGTCGACCGGGGCGCGGGCTCCATCCGGGAAGCCGGTGGGGCCTTCGGAAAGAGAGAGCAGGCTGAAGAGGAACGATATTTCCGACATTACAGGTTATGCTTTGAGATCTCTTTGGGGTGAAGGATTGAAATTAAACCCTGAGCCACCGTGTCCTTGTAGAGCACAGAGTAGAGAACAACTGGCAGCTTTGAAAAAACACCATGAAGAAGAAATCGTTCATCATAAGAAGGAGATTGAGCGTCTGCAGAAAGAAATTGAGCGCCATAAGCAGAAGATCAAAATGCTAAAACATGATGATTAAGTGCACACCGTGTGCCATAGAATGGCACATGTCATTGCCCACTTCTGTGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ATPIF1(93974)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yuyu Zhang et al.
Frontiers in immunology, 12, 590447-590447 (2021-03-16)
MicroRNAs (miRNAs) have been discovered to dictate the development of various tumors. However, studies on the roles of miRNAs in the progression of gastric cancer (GC) are still lacking. Herein, by analyzing GC cell lines and patients samples, we observed
Kévin Hardonnière et al.
Scientific reports, 7(1), 195-195 (2017-03-17)
Most tumors undergo metabolic reprogramming towards glycolysis, the so-called Warburg effect, to support growth and survival. Overexpression of IF1, the physiological inhibitor of the F0F1ATPase, has been related to this phenomenon and appears to be a relevant marker in cancer.
Pamela Maher
Antioxidants (Basel, Switzerland), 10(1) (2021-01-21)
Although the hallmarks of Alzheimer's disease (AD) are amyloid beta plaques and neurofibrillary tangles, there is growing evidence that neuroinflammation, mitochondrial dysfunction and oxidative stress play important roles in disease development and progression. A major risk factor for the development
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU141171-20UG | 04061828639113 |
| EHU141171-50UG | 04061828414277 |