Quality Segment
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATAGGGGGAATGGCAAAAACCAAGTGGAGCAGAGTCCTCAGTCCCTGATCATCCTGGAGGGAAAGAACTGCACTCTTCAATGCAATTATACAGTGAGCCCCTTCAGCAACTTAAGGTGGTATAAGCAAGATACTGGGAGAGGTCCTGTTTCCCTGACAATCATGACTTTCAGTGAGAACACAAAGTCGAACGGAAGATATACAGCAACTCTGGATGCAGACACAAAGCAAAGCTCTCTGCACATCACAGCCTC
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany