Skip to Content
Merck
CN

EHU144441

MISSION® esiRNA

targeting human SNX5

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human SNX5

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTCGCTTCAGATTGACATACCTGATGCGCTCAGTGAGAGAGACAAAGTCAAATTTACAGTGCACACAAAGACCACACTGCCCACGTTTCAGAGCCCAGAGTTTTCTGTTACAAGGCAACATGAAGACTTTGTGTGGCTACATGACACTCTTATTGAAACAACAGACTATGCTGGGCTTATTATTCCACCTGCTCCTACGAAGCCCGACTTTGATGGTCCTCGAGAGAAGATGCAGAAACTGGGAGAAGGTGAAGGGTCTATGACCAAAGAAGAATTTGCCAAGATGAAACAAGAACTGGAAGCTGAGTATCTCGCTGTGTTTAAGAAGACTGTGTCCTCCCATGAAGTCTTTCTTCAGCGGCTTTCTTCTCACCCTGTTCTCAGTAAAGATCGCAACTTTCATGTTTTCCTGGAATATGATCAGGATCTAAGTGTTAGGCGGAAAAATACTAAAGAGATGTTTGGTGGCTTCTTCAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jinyang Cai et al.
Journal of Cancer, 10(13), 2942-2952 (2019-07-10)
Head and neck squamous cell carcinoma (HNSCC) is the sixth most prevalent cancer worldwide. Long-term survival rates in patients with HNSCC have not increased significantly in the past 30 years. Therefore, looking for novel molecular targets that control HNSCC progression
Nao Itai et al.
PloS one, 13(11), e0207205-e0207205 (2018-11-13)
Sorting nexin 5 (SNX5), a member of sorting nexin family, plays an important role in membrane trafficking, including the retrograde trafficking of the cation independent mannose 6-phosphate receptor (CI-M6PR) and macropinocytosis. Using ESI-LCMS/MS analysis, we confirmed that SNX5 serine 226
Fengmin Li et al.
Endocrinology, 156(6), 2211-2221 (2015-04-01)
Sorting nexin 5 (SNX5) belongs to the SNX family, which is composed of a diverse group of proteins that mediate trafficking of plasma membrane proteins, receptors, and transporters. SNX5 is important in the resensitization of the dopamine D1-like receptor (D1R).
Ming Sun et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2730-2748 (2020-01-08)
The small GTPase Ras-related protein Rab-7a (Rab7a) serves as a key organizer of the endosomal-lysosomal system. However, molecular mechanisms controlling Rab7a activation levels and subcellular translocation are still poorly defined. Here, we demonstrate that type Igamma phosphatidylinositol phosphate 5-kinase i5

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service