Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGCCAACCCCATCATTTACTTCTTCGTGGGCTCTTTTAGGAAGCAGTGGCGGCTGCAGCAGCCGATCCTCAAGCTGGCTCTCCAGAGGGCTCTGCAGGACATTGCTGAGGTGGATCACAGTGAAGGATGCTTCCGTCAGGGCACCCCGGAGATGTCGAGAAGCAGTCTGGTGTAGAGATGGACAGCCTCTACTTCCATCAGATATATGTGGCTTTGAGAGGCAACTTTGCCCCTGTCTGTCTGATTTGCTGAACTTTCTCAGTCCTGATTTTAAAACAGTTAAGAGAGTCCTTGTGAGGATTAAGTGAGACAGTGCCTATGAAACAAACACTAAGTGCAGTGTCTCTGGAACTGCCTTACTCACAGGCTTCCACCACAGCCCTATGAGAGCTTTGCCAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MRGPRX2(117194)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ibrahim Alkanfari et al.
Cells, 8(4) (2019-04-17)
Host-defense peptides (HDPs) have an important therapeutic potential against microbial infections but their metabolic instability and cellular cytotoxicity have limited their utility. To overcome these limitations, we utilized five small-molecule, nonpeptide HDP mimetics (smHDPMs) and tested their effects on cytotoxicity
Yingzhuan Zhan et al.
Chemico-biological interactions, 308, 304-311 (2019-05-28)
Polymyxin B (PMB) and polymyxin E (PME) are cyclic, peptide antibiotics which derived from various species of Paenibacillus (Bacillus) polymyxa. They are decapeptide antibiotics with an antimicrobial spectrum that includes Gram-negative bacteria, and reused as therapeutic agents due to the
Yuanyuan Lin et al.
Journal of separation science, 41(11), 2488-2497 (2018-03-02)
Adverse drug reactions of Danshen injection mainly manifested as pseudoallergic reactions. In the present study, salvianolic acid A and a pair of geometric isomers (isosalvianolic acid C and salvianolic acid C) were identified as pseudoallergic components in Danshen injection by
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU145411-20UG | 04061831365672 |
| EHU145411-50UG | 04061828425600 |