Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCCAACGTGGAGAACCTACCCCCGCACATCATCCGCCTGGTGTACAAGGAGGTGACGACACTGACCGCAGACCCACCCGATGGCATCAAGGTCTTTCCCAACGAGGAGGACCTCACCGACCTCCAGGTCACCATCGAGGGCCCTGAGGGGACCCCATATGCTGGAGGTCTGTTCCGCATGAAACTCCTGCTGGGGAAGGACTTCCCTGCCTCCCCACCCAAGGGCTACTTCCTGACCAAGATCTTCCACCCGAACGTGGGCGCCAATGGCGAGATCTGCGTCAACGTGCTCAAGAGGGACTGGACGGCTGAGCTGGGCATCCGACACGTACTGCTGACCATCAAGTGCCTGCTGATCCACCCTAACCCCGAGTCTGCACTCAACGAGGAGGCGGGCCGCCTGCTCTTGGAGAACTACGAGGAGTATGCGGCTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... UBE2S(27338)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Peng Kuang et al.
Scientific reports, 6, 37441-37441 (2016-12-03)
SAG/RBX2 and RBX1 are two family members of RING components of Cullin-RING ligases (CRLs), required for their enzymatic activity. Previous studies showed that SAG prefers to bind with CUL5, as well as CUL1, whereas RBX1 binds exclusively to CULs1-4. Detailed
Shusaku Yoshimura et al.
Biochemical and biophysical research communications, 485(4), 820-825 (2017-03-05)
Ubiquitin-conjugating enzyme E2S (UBE2S), a family of E2 protein in the ubiquitin-proteasome system, is highly expressed in several types of cancers; however, its roles in oral squamous cell carcinoma (OSCC) have not yet been well elucidated. The purpose of this
Tsung-Han Lin et al.
Food & function, 8(4), 1558-1568 (2017-03-10)
We previously reported that the dietary flavonoids, luteolin and quercetin, might inhibit the invasiveness of cervical cancer by reversing epithelial-mesenchymal transition (EMT) signaling. However, the regulatory mechanism exerted by luteolin and quercetin is still unclear. This study analyzed the invasiveness
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU147811-20UG | 04061828652914 |
| EHU147811-50UG | 04061828427666 |