Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACTACAGGGCACAAGGCTGTCAGATGGCCAGGGCTTCACCCAGGATGACATACAGGCTGGCCGGGTGACCTATGGGGCCACAGCACGTGCCTCAGAGGCAGTCGAGGACACCTTCCGTTTCCGTGTCACAGCTCCACCATATTTCTCCCCACTCTATACCTTCCCCATCCACATTGGTGGTGACCCAGATGCGCCTGTCCTCACCAATGTCCTCCTCGTGGTGCCTGAGGGTGGTGAGGGTGTCCTCTCTGCTGACCACCTCTTTGTCAAGAGTCTCAACAGTGCCAGCTACCTCTATGAGGTCATGGAGCGGCCCCGCCATGGGAGGTTGGCTTGGCGTGGGACACAGGACAAGACCACTATGGTGACATCCTTCACCAATGAAGACCTGTTGCGTGGCCGGCTGGTCTACCAGCATGATGACTCCGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CSPG4(1464)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jianbo Yang et al.
Melanoma research, 29(4), 365-375 (2019-05-30)
Chondroitin sulfate proteoglycan 4 (CSPG4) is a cell surface proteoglycan that enhances malignant potential in melanoma and several other tumor types. CSPG4 functions as a transmembrane scaffold in melanoma cells to activate oncogenic signaling pathways such as focal adhesion kinase
Sridevi Yadavilli et al.
Oncotarget, 6(14), 12141-12155 (2015-05-20)
Diffuse intrinsic pontine gliomas (DIPGs) have a dismal prognosis and are poorly understood brain cancers. Receptor tyrosine kinases stabilized by neuron-glial antigen 2 (NG2) protein are known to induce gliomagenesis. Here, we investigated NG2 expression in a cohort of DIPG
Frank Maus et al.
PloS one, 10(9), e0137311-e0137311 (2015-09-05)
The NG2 proteoglycan is characteristically expressed by oligodendrocyte progenitor cells (OPC) and also by aggressive brain tumours highly resistant to chemo- and radiation therapy. Oligodendrocyte-lineage cells are particularly sensitive to stress resulting in cell death in white matter after hypoxic
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU149911-20UG | 04061828640034 |
| EHU149911-50UG | 04061828406494 |