Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGAGATGGGTCACAGTCCAGGTGCAGGGCCAGGAGGTCCTATCAGAGAAGATGGAGCCCTCCAGTTTCCAGCCCCTACCTGAAACTGAGCCTCCAACTCCAGAGCCTGGGCCCAAGACACCTCCTAGGACTATGCAGGAATCACCACTGGGCCTGCAGGTGAAAGAGGAGTCAGAGGTTACAGAGGACTCAGATTTCCTGGAGTCTGGGCCTCTAGCTGCCACCCAGGAGTCTGTACCCACCCTCCTGCCTGAGGAGGCCCAGAGATGTGGGACCGTGCTGGACCAGATCTTTCCCCACAGCAAGACTGGGCCTGAGGGTCCCTCATGGAGGGAGCACCCCAGGGCCCTGTGGCATGAGGAAGCTGGGGGCATCTTCTCCCCAGGGTTCGCGCTGCAGCTAGGCAGCATCTCCGCAGGTCCAGGTAGTGTAAGCCCTCACCTCCAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MZF1(7593)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
C E Weber et al.
Oncogene, 34(37), 4821-4833 (2014-12-23)
Interactions between tumor cells and cancer-associated fibroblasts (CAFs) in the tumor microenvironment significantly influence cancer growth and metastasis. Transforming growth factor-β (TGF-β) is known to be a critical mediator of the CAF phenotype, and osteopontin (OPN) expression in tumors is
Lanfang Wu et al.
The FEBS journal, 284(18), 3000-3017 (2017-07-14)
Tumor metastasis remains a major obstacle for improving overall cancer survival in cervical cancer (CC), which may be due to the existence of tumor microenvironment-related cancer stem cells (CSCs) and epithelial-mesenchymal transition (EMT). The mechanism underlying these processes needs to
Keito Okazaki et al.
Nature communications, 11(1), 5911-5911 (2020-11-22)
Transcriptional dysregulation, which can be caused by genetic and epigenetic alterations, is a fundamental feature of many cancers. A key cytoprotective transcriptional activator, NRF2, is often aberrantly activated in non-small cell lung cancers (NSCLCs) and supports both aggressive tumorigenesis and
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU151161-50UG | 04061828407675 |
| EHU151161-20UG | 04061828634842 |