Skip to Content
Merck
CN

EHU151861

Sigma-Aldrich

MISSION® esiRNA

targeting human VIM

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTTGAACGCAAAGTGGAATCTTTGCAAGAAGAGATTGCCTTTTTGAAGAAACTCCACGAAGAGGAAATCCAGGAGCTGCAGGCTCAGATTCAGGAACAGCATGTCCAAATCGATGTGGATGTTTCCAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAATATGAAAGTGTGGCTGCCAAGAACCTGCAGGAGGCAGAAGAATGGTACAAATCCAAGTTTGCTGACCTCTCTGAGGCTGCCAACCGGAACAATGACGCCCTGCGCCAGGCAAAGCAGGAGTCCACTGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGATGCCCTTAAAGGAACCAATGAGTCCCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCCGTTGAAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... VIM(7431), VIM(7431)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wei Wu et al.
Virology, 497, 41-52 (2016-07-17)
Influenza A virus exploits the subcellular transport machinery during the early stages of infection. Actin filaments and microtubules facilitate the trafficking of virus-containing endosomes towards the perinuclear region; however, the role of vimentin remains to be determined. In this study
Brian Koons et al.
ACS nano, 11(12), 12037-12048 (2017-11-17)
Cell migration is studied with the traditional focus on protrusion-driven cell body displacement, while less is known on morphodynamics of individual protrusions themselves, especially in fibrous environments mimicking extracellular matrix. Here, using suspended fibers, we report integrative and multiscale abilities
Shih-Hung Chan et al.
Oncotarget, 8(25), 41364-41378 (2017-05-11)
The association between metabolic diseases and the risk of developing cancer is emerging. However, the impact of long pentraxin-3 (PTX3) on dyslipidemia-associated tumor metastasis remains unknown. In this study, we found that oleate induced PTX3 expression and secretion through the
Alison E Patteson et al.
Small (Weinheim an der Bergstrasse, Germany), 15(50), e1903180-e1903180 (2019-11-14)
The migration of cells through constricting spaces or along fibrous tracks in tissues is important for many biological processes and depends on the mechanical properties of a cytoskeleton made up of three different filaments: F-actin, microtubules, and intermediate filaments. The
Fu Jun Li et al.
American journal of physiology. Lung cellular and molecular physiology, 313(1), L80-L91 (2017-04-30)
Exposure to cadmium (Cd) has been associated with development of chronic obstructive lung disease (COPD). The mechanisms and signaling pathways whereby Cd causes pathological peribronchiolar fibrosis, airway remodeling, and subsequent airflow obstruction remain unclear. We aimed to evaluate whether low-dose

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service