Skip to Content
Merck
CN

EHU154771

Sigma-Aldrich

MISSION® esiRNA

targeting human SLCO2A1

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTGCAGATCTTTGTGGACTATGGCAGGGTCAACACAGCTGCAGTTAACTTGGTCCCGGGTGACCCCCGATGGATTGGAGCCTGGTGGCTAGGCCTGCTCATTTCTTCAGCTTTATTGGTTCTCACCTCTTTCCCCTTTTTTTTCTTCCCTCGAGCAATGCCCATAGGAGCAAAGAGGGCTCCTGCCACAGCAGATGAAGCAAGGAAGTTGGAGGAGGCCAAGTCAAGAGGCTCCCTGGTGGATTTCATTAAACGGTTTCCATGCATCTTTCTGAGGCTCCTGATGAACTCACTCTTCGTCCTGGTGGTCCTGGCCCAGTGCACCTTCTCCTCCGTCATTGCTGGCCTCTCCACCTTCCTCAACAAGTTCCTGGAGAAGCAGTATGGCACCTCAGCAGCCTATGCCAACTTCCTCATTGGTGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ahmad Yasser Hamdi Nor Azlan et al.
Saudi pharmaceutical journal : SPJ : the official publication of the Saudi Pharmaceutical Society, 28(11), 1420-1430 (2020-12-01)
Diabetic wounds are difficult to treat due to multiple causes, including reduced blood flow and bacterial infections. Reduced blood flow is associated with overexpression of prostaglandin transporter (PGT) gene, induced by hyperglycaemia which causing poor vascularization and healing of the
Antonio Madrigal-Martínez et al.
Journal of cellular physiology, 234(5), 7548-7559 (2018-10-28)
Cyclooxygenase (COX)-derived prostaglandin E2 (PGE2 ) affects many mechanisms that have been shown to play roles in carcinogenesis. Recently, we found that, in androgen-independent prostate cancer PC3 cells, PGE2 acts through an intracrine mechanism by which its uptake by the
Zhongbo Liu et al.
PloS one, 10(7), e0133615-e0133615 (2015-08-01)
Peripheral ischemia, resulting from diminished arterial flow and defective local vascularization, is one of the main causes of impaired wound healing in diabetes. Vasodilatory prostaglandins (PGs), including PGE2 and PGI2, regulate blood flow in peripheral tissues. PGs also stimulate angiogenesis

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service