Skip to Content
Merck
CN

EHU157631

MISSION® esiRNA

targeting human KIAA1524

Sign In to View Organizational & Contract Pricing.

Select a Size

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human KIAA1524

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTGGCAATCATCAAATCACAGTTTTCCAACATCAATAAAGTGTTTAACTCCTCATTTGAAAGATGGTGTTCCTGGATTGAATATTGAAGAATTAATAGAGAAACTTCAGTCTGGAATGGTGGTAAAGGATCAGATTTGTGATGTGAGAATATCTGACATAATGGATGTATATGAAATGAAACTATCCACATTAGCTTCCAAAGAAAGCAGGCTACAAGATCTTTTGGAAACAAAAGCTCTAGCCCTTGCACAGGCTGATAGACTGATTGCTCAGCATCGCTGTCAAAGAACTCAAGCTGAAACAGAGGCACGGACACTTGCTAGTATGTTGAGAGAAGTTGAGAGAAAAAATGAAGAGCTTAGTGTGTTGCTGAAGGCGCAGCAAGTTGAATCAGAAAGAGCGCAGAGTGA

Ensembl | human accession no.

ENSG00000163507

NCBI accession no.

NM_020890

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... KIAA1524(57650), KIAA1524(57650)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lisa P Huang et al.
Cancer medicine, 1(1), 76-81 (2013-01-24)
Bladder cancer is one of the most common cancers in the United States. Numerous markers have been evaluated for suitability of bladder cancer detection and surveillance. However, few of them are acceptable as a routine tool. Therefore, there exists a
Xu-Dong Chen et al.
Oncology reports, 38(2), 1005-1012 (2017-06-29)
Laryngeal carcinoma is one of the most common malignant tumors in otorhinolaryngology. Moreover, experimental investigation showed that cancerous inhibitor of protein phosphatase 2A (CIP2A) expressed highly in various cancers. Therefore, we investigated whether CIP2A can regulate the proliferation, invasion and
Yongzhen Zhang et al.
Journal of Cancer, 9(21), 4029-4038 (2018-11-10)
CIP2A is a well-known oncoprotein whose expression is elevated in multiple human solid tumor types. However, its role in renal cell carcinoma (RCC) development is poorly understood. Thus, in our present study, we used the renal cancer cell lines 786-O
Liliana Cantini et al.
PloS one, 8(9), e73348-e73348 (2013-09-11)
Despite a better understanding of the pathogenesis of oral cancer, its treatment outcome remains poor. Thus, there is a need for new therapeutic strategies to improve the prognosis of this disease. RNA interference (RNAi) appears to be a promising therapeutic
Hyun Min Jung et al.
Molecular biology of the cell, 24(11), 1638-1648 (2013-04-05)
MicroRNAs (miRNAs) are small, noncoding RNAs involved in posttranscriptional regulation of protein-coding genes in various biological processes. In our preliminary miRNA microarray analysis, miR-375 was identified as the most underexpressed in human oral tumor versus controls. The purpose of the
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service