Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCTGGCAATCATCAAATCACAGTTTTCCAACATCAATAAAGTGTTTAACTCCTCATTTGAAAGATGGTGTTCCTGGATTGAATATTGAAGAATTAATAGAGAAACTTCAGTCTGGAATGGTGGTAAAGGATCAGATTTGTGATGTGAGAATATCTGACATAATGGATGTATATGAAATGAAACTATCCACATTAGCTTCCAAAGAAAGCAGGCTACAAGATCTTTTGGAAACAAAAGCTCTAGCCCTTGCACAGGCTGATAGACTGATTGCTCAGCATCGCTGTCAAAGAACTCAAGCTGAAACAGAGGCACGGACACTTGCTAGTATGTTGAGAGAAGTTGAGAGAAAAAATGAAGAGCTTAGTGTGTTGCTGAAGGCGCAGCAAGTTGAATCAGAAAGAGCGCAGAGTGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... KIAA1524(57650)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Lisa P Huang et al.
Cancer medicine, 1(1), 76-81 (2013-01-24)
Bladder cancer is one of the most common cancers in the United States. Numerous markers have been evaluated for suitability of bladder cancer detection and surveillance. However, few of them are acceptable as a routine tool. Therefore, there exists a
Xu-Dong Chen et al.
Oncology reports, 38(2), 1005-1012 (2017-06-29)
Laryngeal carcinoma is one of the most common malignant tumors in otorhinolaryngology. Moreover, experimental investigation showed that cancerous inhibitor of protein phosphatase 2A (CIP2A) expressed highly in various cancers. Therefore, we investigated whether CIP2A can regulate the proliferation, invasion and
Shihua Zhang et al.
OncoTargets and therapy, 13, 4063-4074 (2020-06-05)
Recent evidence showed cancerous inhibitor of protein phosphatase 2A (CIP2A) plays carcinogenesis roles in several types of human cancer. However, the expression and function of CIP2A in gliomas are unknown. qRT-PCR, IHC and Western blot were used to evaluate CIP2A
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU157631-50UG | 04061828419128 |
| EHU157631-20UG | 04061831367485 |