Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGGCTTGTGATGGCTACAATGGCTCCTAGACACTCAACGACTTCATCTGTGGCAGGGAGAGAGGAGGCCGGAAGAACAACCCCTGAACAATGGAGGCCTTTCTTTCCCGCTAGGCTCCCAGCCTCCTTCCCGCTACAGAATCGCTCATCGGCGAGGCTCAGCAGAAAGACCCTGAAGGCAGGCTGCAAATGACCCAGAAGAGGGACCTGGGAGTCCTGGTGGGGACGGGGAGGGAGTCTCAATACTCCTTTGCAGTGCAAGGTACTCTGAGTCCCCTCTGTAGTGCCTCTGCCAGACACACACTGCCTGAGTTGAAGAGACACAGGCCACACA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... GPR17(2840)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Simona Cosentino et al.
Journal of cellular and molecular medicine, 18(9), 1785-1796 (2014-06-10)
GPR17 is a G(i) -coupled dual receptor activated by uracil-nucleotides and cysteinyl-leukotrienes. These mediators are massively released into hypoxic tissues. In the normal heart, GPR17 expression has been reported. By contrast, its role in myocardial ischaemia has not yet been
Zhangfu Wang et al.
International immunopharmacology, 88, 106870-106870 (2020-08-18)
Osteoarthritis (OA) is a common joint disease affecting millions of elderly people worldwide. However, the mechanism of OA is complicated and remains poorly understood. Thus, a safe and effective therapeutic strategy has yet to be developed. G protein-coupled receptor 17
Bing Zhao et al.
International journal of molecular medicine, 42(5), 2750-2762 (2018-09-19)
GPR17 is a G (i)-coupled dual receptor, linked to P2Y and CysLT receptors stimulated by uracil nucleotides and cysteinyl leukotrienes, respectively. Recent evidence has demonstrated that GPR17 inhibition ameliorates the progression of cerebral ischemic injury by regulating neuronal death and
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU159091-50UG | 04061828420346 |
| EHU159091-20UG | 04061828645237 |