Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGTCCACCAGTCACCACACCAACGACTGCACAGATACGTGGAGCTTGCCTGGGGCTTCTCTACTGCCTTGGGTACCTTTCTCTTCCTGGCTGAAGTTGTTCTGGTGGGCTGGGTCAAGTTTGTGCCCATTGGGGCACCCATGGGTAAACCAGCTCCTGTTGTACCTATGTCCCAGGTGCCACCTGTGACTGTCTCCCTTAGTTTAGCTTCTAACCTCACACCATCCTCTGCTTCTATTACCACATCACAACAGCCTTCCAAAGCCTGTCCACCCCGGCAAGTGTGTGATAGTGCTCATGGACCAGGCTGGCAGGCAGCTATGGCCTCCACGGCAATCATGGTACCTGTGGGACTAGTGTTTATGGCCTTTGCCCTACATTTCTACCGATCCTTGGTTGC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... ORAI3(269999), Orai3(269999)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Carlos Cantonero et al.
International journal of molecular sciences, 21(9) (2020-05-13)
Arachidonic acid (AA) is a phospholipase A2 metabolite that has been reported to mediate a plethora of cellular mechanisms involved in healthy and pathological states such as platelet aggregation, lymphocyte activation, and tissue inflammation. AA has been described to activate
Michael A Thompson et al.
American journal of respiratory cell and molecular biology, 51(1), 68-76 (2014-01-30)
Plasma membrane Ca(2+) influx, especially store-operated Ca(2+) entry triggered by sarcoplasmic reticulum (SR) Ca(2+) release, is a key component of intracellular calcium concentration ([Ca(2+)]i) regulation in airway smooth muscle (ASM). Agonist-induced Ca(2+) oscillations in ASM that involve both influx and
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU000241-50UG | 04061828432387 |
| EMU000241-20UG | 04061828658220 |