EMU010011
MISSION® esiRNA
targeting mouse Tlr2
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGACACTGGGGGTAACATCGCTTTTTCCCAATCTCACAAATTTACAAACCCTCAGGATAGGAAATGTAGAGACTTTCAGTGAGATAAGGAGAATAGATTTTGCTGGGCTGACTTCTCTCAATGAACTTGAAATTAAGGCATTAAGTCTCCGGAATTATCAGTCCCAAAGTCTAAAGTCGATCCGCGACATCCATCACCTGACTCTTCACTTAAGCGAGTCTGCTTTCCTGCTGGAGATTTTTGCAGATATTCTGAGTTCTGTGAGATATTTAGAACTAAGAGATACTAACTTGGCCAGGTTCCAGTTTTCACCACTGCCCGTAGATGAAGTCAGCTCACCGATGAAGAAGCTGGCATTCCGAGGCTCGGTTCTCACTGATGAAAGCTTTAACGAGCTCCTGAAGCTGTTGCGTTACA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... TLR2(24088), Tlr2(24088)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Seung Heon Shin et al.
Allergy, asthma & immunology research, 8(1), 63-68 (2015-11-06)
Chronic rhinosinusitis with nasal polyps is a chronic inflammatory disease with markedly increased eosinophils, Th2-type lymphocytes, fibroblasts, and goblet cells. Fungi are commonly associated with airway inflammatory diseases, and thymic stromal lymphopoietin (TSLP) is important in the development of Th2
Min Li et al.
Biochemical and biophysical research communications, 466(4), 748-754 (2015-10-02)
Microphage apoptosis is a critical event in atherosclerotic lesions in patients with diabetes. In the present investigation, high glucose treatment inhibited Akt phosphorylation and activated caspase 3 in primary peritoneal macrophage, leading to cell apoptosis. Hypoxia prolonged macrophage survival in
Megumi Inomata et al.
PloS one, 13(8), e0202791-e0202791 (2018-08-29)
Porphyromonas gingivalis possesses various abilities to evade and disrupt host immune responses, by which it acts as an important periodontal pathogen. P. gingivalis produces outer membrane protein A (OmpA)-like proteins (OmpALPs), Pgm6 and Pgm7, as major O-linked glycoproteins, but their
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU010011-50UG | 04061828439782 |
| EMU010011-20UG | 04061828665150 |