Skip to Content
Merck
CN

EMU014431

MISSION® esiRNA

targeting mouse Bsg

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCCTGCATCTTCCTTCCTGAGCCTGTGGGCAGAAGCGAGATCAATGTGGAAGGGCCACCCAGGATCAAGGTCGGAAAGAAATCAGAGCATTCCAGTGAGGGAGAGCTTGCGAAACTGGTCTGCAAGTCCGATGCATCCTACCCTCCTATTACAGATTGGTTCTGGTTTAAGACCTCTGACACTGGGGAAGAAGAGGCAATCACCAATAGCACTGAAGCCAATGGCAAGTATGTGGTGGTATCCACGCCTGAGAAGTCACAGCTGACCATCAGCAACCTTGACGTAAATGTTGACCCTGGCACCTACGTGTGTAATGCCACCAACGCCCAGGGCACTACTCGGGAAACCATCTCACTGCGTGTGCGGAGCCGCATGGCAGCCCTCTGGCCCTTCCTAGGCATCGTGGCTGAGGTCCTGGTGTTGGTT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lipan Peng et al.
Molecular and cellular biochemistry, 405(1-2), 73-79 (2015-04-12)
Chemotherapy remains the core of anticancer treatment. However, despite the tremendous strides made in the development of targeted anticancer therapies, emergence of resistance to chemotherapeutic drugs is still a major obstacle in the successful management of resistant tumors. Therefore, profound
Eleni Milia-Argeiti et al.
Biochimica et biophysica acta, 1840(8), 2581-2588 (2014-03-13)
Elevated levels of EMMPRIN/CD147 in cancer tissues have been correlated with tumor progression but the regulation of its expression is not yet understood. Here, the regulation of EMMPRIN expression was investigated in testicular germ cell tumor (TGCTs) cell lines. EMMPRIN
Juan Tang et al.
Oncotarget, 6(33), 34831-34845 (2015-10-27)
Oscillations in intracellular Ca2+ concentrations ([Ca2+]i) mediate various cellular function. Although it is known that [Ca2+]i oscillations are susceptible to dysregulation in tumors, the tumor-specific regulators of [Ca2+]i oscillations are poorly characterized. We discovered that CD147 promotes hepatocellular carcinoma (HCC)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service