Skip to Content
Merck
CN

EMU036501

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tsc22d3

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGGTTCTGCGGTGTAAGTGGCTCTGTCCTTAGGGTGGGCAGAGCCACATCTTGTTCTACCTAGTTCTTTCCAGTTTGTTTTTGGCTCCCCAAGCGTCATCTCATGTGGAGAACTTTACACCTAACATAGCTGGTGCCAAGAGATGTCCCAAGGACATGCCCATCTGGGTCCACTCCAGTGACAGACCCCTGACAAAGAGCAGGTCTCTGGAGACTAAGTTGCATGGGGCCTAGTAACACCAAGCCAGTGAGCCTGTCGTGTCACCGGGCCCTGGGGGCTCCCAGGGCCTGGGCAACTTAGTTACAGCTGACCAAGGAGAAAGTAGTTTTGAGATGTGATGCCAGTGTGCTCCAGAAAGTGTAAGGGGTCTGTTTTTCATTTCCATGGACATCTTCCACAGCTTCACCTGACAATGACTGTTCCTATGAAGAAGCCACTTGTGTTCTAAGCAGAAGCAACCTCTCTCTTCTTCTCTGTCTTTTCCAGGCAGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nassima Redjimi et al.
Molecular cancer, 8, 83-83 (2009-10-10)
Little is known about the molecules that contribute to tumor progression of epithelial ovarian cancer (EOC), currently a leading cause of mortality from gynecological malignancies. Glucocorticoid-Induced Leucine Zipper (GILZ), an intracellular protein widely expressed in immune tissues, has been reported
Jeffrey S Futterleib et al.
Transfusion and apheresis science : official journal of the World Apheresis Association : official journal of the European Society for Haemapheresis, 50(3), 379-387 (2013-11-13)
Extracorporeal photochemotherapy (ECP) is a widely used method for either immunization against cutaneous T cell lymphoma or immunosuppression of graft-versus-host disease and organ transplant rejection (OTR). Leukapheresed blood is routed through a chamber, in which 8-methoxypsoralen is activated by ultraviolet
Huapeng Fan et al.
Arthritis & rheumatology (Hoboken, N.J.), 66(8), 2059-2070 (2014-05-02)
Glucocorticoids remain a mainstay in the treatment of rheumatoid arthritis (RA). Dose-dependent adverse effects highlight the need for therapies that regulate glucocorticoid sensitivity to enable dosage reduction. Macrophage migration inhibitory factor (MIF) is a proinflammatory protein that has been implicated

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service