Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGTGCCGCGTCAGTCATGCCGAAGCACGAGTTCTCCGTGGACATGACCTGTGAGGGCTGTGCTGAAGCCGTCTCCAGAGTCCTCAACAAGCTGGGAGGAGTGGAGTTCAACATTGACCTGCCCAACAAGAAGGTCTGCATCGACTCTGAGCACAGCTCAGACACCCTGCTGGCAACCCTCAACAAAACAGGAAAGGCTGTTTCCTACCTTGGCCCCAAGTAGCCAGGACCTGGGCGAGTCCTTCCGGATATAAACTGAAGAGGCAGGCTGTTGATCTGGTCTCCCCGGCAGATCTGGAACACCAACTGCTCAGTCCAGTCCAGCCCAGCCATGGAGTTCCTGCCCAGACAGGCCTTCCCCGCTGGCTCCCTGCAAGCTTCCATGTAATAAAGTCAAGCTGAGTTT
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... ATOX1(11927), Atox1(11927)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Huawei Cai et al.
Oncology reports, 30(1), 269-275 (2013-04-30)
Copper is required for cell proliferation and tumor angiogenesis. Cellular copper metabolism is regulated by a network of copper transporters and chaperones. Antioxidant-1 (ATOX1) is a cytosolic copper chaperone important for intracellular copper transport, which plays a role in the
Gin-Fu Chen et al.
Scientific reports, 5, 14780-14780 (2015-10-07)
Copper (Cu), an essential micronutrient, plays a fundamental role in inflammation and angiogenesis; however, its precise mechanism remains undefined. Here we uncover a novel role of Cu transport protein Antioxidant-1 (Atox1), which is originally appreciated as a Cu chaperone and
Arundhati Jana et al.
PloS one, 15(1), e0227916-e0227916 (2020-01-22)
Colorectal cancer remains a deadly cancer due to metastatic disease. To understand the molecular mechanisms of metastasis in colon cancer, we investigated whether the copper chaperone antioxidant-1 (Atox1) protein plays a role in this process. Recent findings indicate that Atox1
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU046811-20UG | 04061828516612 |
| EMU046811-50UG | 04061828292660 |